ID: 1011128111

View in Genome Browser
Species Human (GRCh38)
Location 6:84028751-84028773
Sequence TTGGTTAGAAGGCCTTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011128104_1011128111 19 Left 1011128104 6:84028709-84028731 CCAGCTACAGCTTTGTTATTCAG No data
Right 1011128111 6:84028751-84028773 TTGGTTAGAAGGCCTTCCACTGG No data
1011128109_1011128111 -5 Left 1011128109 6:84028733-84028755 CCTAGGCTATTTGGAGTCTTGGT No data
Right 1011128111 6:84028751-84028773 TTGGTTAGAAGGCCTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011128111 Original CRISPR TTGGTTAGAAGGCCTTCCAC TGG Intergenic
No off target data available for this crispr