ID: 1011131025

View in Genome Browser
Species Human (GRCh38)
Location 6:84051915-84051937
Sequence CGTCTTCCCCAACAATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011131017_1011131025 17 Left 1011131017 6:84051875-84051897 CCTGCTCACCACGCTTTCTCTGT 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1011131025 6:84051915-84051937 CGTCTTCCCCAACAATGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 83
1011131020_1011131025 9 Left 1011131020 6:84051883-84051905 CCACGCTTTCTCTGTTTGGGTTT 0: 1
1: 0
2: 0
3: 16
4: 245
Right 1011131025 6:84051915-84051937 CGTCTTCCCCAACAATGGGCTGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011131025 Original CRISPR CGTCTTCCCCAACAATGGGC TGG Intronic
901463717 1:9407127-9407149 GGTCTGCACCAACACTGGGCTGG - Intergenic
901635669 1:10669072-10669094 CGTTTTCCCCAACCCTGTGCAGG - Intronic
902777494 1:18684145-18684167 CTTCTTCCCCAGCAATGGCAGGG - Intronic
904472858 1:30746582-30746604 TCTCTCCCCCAACAATGCGCAGG + Intronic
905344865 1:37304469-37304491 CTTCTTCCCCAGGAATGTGCAGG - Intergenic
905576335 1:39047628-39047650 GGGCTTCCACAAGAATGGGCTGG + Intergenic
906735404 1:48121417-48121439 CATTTTCCTCAACAATGGGCAGG - Intergenic
908926269 1:69258681-69258703 CATCTTCCCCAACAAAGGAATGG - Intergenic
916032380 1:160889094-160889116 CTTCTCCCTCAACAATGGGATGG + Intergenic
918245553 1:182656531-182656553 CATCTTTCCCAACCATGGCCAGG + Intronic
920488020 1:206389111-206389133 AGTCTTCCACTACAATGGGAGGG + Intronic
922505529 1:226123403-226123425 CAGCTTCCCCATCAGTGGGCAGG - Intergenic
1062803771 10:399189-399211 GGTGTTCCCCAACAATGATCCGG - Exonic
1062896496 10:1107147-1107169 CATCTTCCTCACCAATGAGCTGG - Intronic
1064475215 10:15681028-15681050 CGTCTTACCCAACAAATGGAAGG + Intronic
1069774537 10:70918931-70918953 GGTCTTCCTCAACAATGGAAGGG - Intergenic
1076117648 10:127911634-127911656 CCCCTTCCCCACCACTGGGCAGG + Intronic
1076143616 10:128098782-128098804 CGTCTGTCCCAACACTGAGCAGG - Exonic
1077900975 11:6488484-6488506 CGCCTTCCCCCACAATGGTGAGG - Intronic
1081506651 11:43724276-43724298 TGTCTTACCCAACAAGGGACTGG + Intronic
1082002461 11:47400497-47400519 TGTCTTCGCCAAAAATGGGAGGG + Intergenic
1083485801 11:62982337-62982359 GGTCTTCCTCAGCTATGGGCTGG + Intronic
1084544742 11:69809269-69809291 CCTGTTCCCCAACAATGGCATGG - Intergenic
1085680272 11:78567270-78567292 TTTCTTCCACAACAATGGCCAGG + Intronic
1086380037 11:86243290-86243312 CATCTTTCCCAACAAAGGGAAGG - Intergenic
1090887076 11:130886936-130886958 ATTCTTCCCCAGCACTGGGCAGG - Intronic
1097186944 12:57201095-57201117 CATCTTCCGCTGCAATGGGCAGG + Exonic
1099148503 12:79078188-79078210 CTTCTTCCCCAACATTGCTCTGG - Intronic
1102010201 12:109613573-109613595 CCTCTGCACCAAGAATGGGCTGG - Intergenic
1104806911 12:131595337-131595359 AGTCTTTTCCAAAAATGGGCAGG + Intergenic
1117783396 14:59257868-59257890 CCTCTTCCCCAACACTTTGCAGG + Intronic
1121625875 14:95385089-95385111 CATCTTCCGGAAGAATGGGCAGG - Intergenic
1124209873 15:27753846-27753868 CGTCATCCCCTACAATGCTCAGG - Intergenic
1125448295 15:39782126-39782148 CTACTTCCCCTACACTGGGCTGG + Intronic
1126056867 15:44738473-44738495 CTTCTTCCCCTAAAAGGGGCTGG + Intronic
1129537917 15:76329470-76329492 TCTCTTCCCCAGAAATGGGCGGG - Intergenic
1131091387 15:89627257-89627279 CAACTTCCCCAACAAGGGGCAGG - Exonic
1136372426 16:29844736-29844758 TGTCTTCCCCCAAAACGGGCTGG + Exonic
1137591715 16:49697860-49697882 ATTGCTCCCCAACAATGGGCTGG - Intronic
1143017583 17:3899131-3899153 CCTCATCCCCAACACCGGGCAGG + Intronic
1143852666 17:9824310-9824332 CGACTTCCCCACCCATTGGCTGG - Intronic
1150743042 17:67795032-67795054 CGTCTTCCCCAGCAAAGAGAGGG - Intergenic
1152408597 17:80110982-80111004 CGGCTGCCCCAACAATGAGCTGG + Intergenic
1157569712 18:48704302-48704324 CCTCTTCCATAAAAATGGGCTGG + Intronic
1157726700 18:49969918-49969940 TGTCCTCCGCAAGAATGGGCTGG + Intronic
1165976364 19:39680251-39680273 CCTCTTCTCCCACAATGGGATGG - Intergenic
928112085 2:28518844-28518866 CCTTTTTCCCCACAATGGGCTGG + Intronic
929552100 2:42900891-42900913 TGTCTTCCCATCCAATGGGCAGG + Intergenic
932128276 2:69164791-69164813 TGTCTTCCCCAACACAGGACGGG + Intronic
934144855 2:89081895-89081917 GGTCTTCCAAAAGAATGGGCCGG + Intergenic
938977290 2:136492140-136492162 AGTGTTCCCCATCAATGGGAAGG + Intergenic
941421190 2:165284511-165284533 CATCTTCCCCATGAATGAGCAGG - Intronic
943674707 2:190705468-190705490 AGCCTTCCCCAACAGAGGGCGGG + Intergenic
944501020 2:200360455-200360477 TGTCCTCCCCAACCAGGGGCAGG + Intronic
948870369 2:240794840-240794862 CGTCTTCGGCTACAGTGGGCAGG + Intronic
1185023294 22:48393135-48393157 CGTCTGCCCACACAAAGGGCTGG - Intergenic
1185384920 22:50527188-50527210 CGTCTTCCCCAACCAGGAGCAGG - Exonic
950416671 3:12872883-12872905 CTCCTTCCCCAACAAAGAGCAGG + Intergenic
952859340 3:37799838-37799860 CGTCATCACCACCAATGAGCTGG - Intronic
953113116 3:39962818-39962840 CATCTTGGCCAAGAATGGGCTGG - Intronic
967336009 3:188345481-188345503 AATGTTCCCCAACAATGTGCAGG - Intronic
968064447 3:195750907-195750929 CGTCTTCCCCGGAGATGGGCTGG + Exonic
969066423 4:4485467-4485489 AGTCTTTTCCAACACTGGGCTGG - Intronic
969189840 4:5508545-5508567 CAGCTTCCCCAACAAGGGGAAGG - Intergenic
975186227 4:71406582-71406604 TGTGTTACCCACCAATGGGCTGG + Intronic
983700089 4:170581374-170581396 TGTCTTCCACAAAACTGGGCTGG - Intergenic
992175602 5:74146252-74146274 GGCCTTCCCCACCACTGGGCAGG - Intergenic
1004917486 6:20345560-20345582 CGTCTTCTCCCACAATTTGCAGG - Intergenic
1004918818 6:20357226-20357248 CATCCTCCCCAACAGTGAGCAGG + Intergenic
1005493479 6:26368599-26368621 CGTCTTCACCCACCATGGCCAGG - Exonic
1005498050 6:26405943-26405965 CGTCTTCACCCACCATGGCCAGG - Exonic
1005502715 6:26443991-26444013 CGTCTTCACCCACCATGGCCAGG - Exonic
1006509870 6:34515928-34515950 CCTCTGCCCCAACTCTGGGCAGG + Intronic
1011131025 6:84051915-84051937 CGTCTTCCCCAACAATGGGCTGG + Intronic
1020784153 7:12553761-12553783 CCTTTTCCAAAACAATGGGCAGG - Intergenic
1021784899 7:24142033-24142055 AGTCATCACCAACAATGTGCTGG - Intergenic
1028444258 7:90901955-90901977 TTTCTTCCCCAATAATGAGCTGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1042328890 8:67556980-67557002 CGTCTCCCCCAACCATGGCAAGG - Intronic
1058451213 9:105098205-105098227 CCTCTACTCCAACAAGGGGCAGG + Intergenic
1060222649 9:121772832-121772854 CGTCCTCCCCACAGATGGGCAGG + Exonic
1061545563 9:131302286-131302308 CCACTTCCCCAAAAATGGCCTGG - Intronic
1062612848 9:137382832-137382854 CGTCTGCCCCCACAGGGGGCCGG + Intronic
1186529065 X:10277192-10277214 CCTCTTCCCCAACCAGGGGTTGG - Intergenic
1186695897 X:12031672-12031694 CAGCTTCCACAACAAGGGGCTGG + Intergenic
1187192858 X:17053087-17053109 GTTCTTCCCCAAAACTGGGCAGG + Intronic
1187316899 X:18204791-18204813 CGTCTTCATCATCAATGTGCTGG - Intronic
1200137841 X:153883564-153883586 CCTCTGCCCCTGCAATGGGCTGG - Intronic