ID: 1011131712

View in Genome Browser
Species Human (GRCh38)
Location 6:84058681-84058703
Sequence GCTTGTGTTTAGAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011131707_1011131712 -2 Left 1011131707 6:84058660-84058682 CCAATGCTGAGCCCTGGGCACGC 0: 1
1: 0
2: 0
3: 24
4: 202
Right 1011131712 6:84058681-84058703 GCTTGTGTTTAGAAGTTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011131712 Original CRISPR GCTTGTGTTTAGAAGTTGGA GGG Intronic
902936689 1:19769706-19769728 GCTGGTGGGAAGAAGTTGGACGG + Intronic
906538935 1:46570114-46570136 CCATGTGACTAGAAGTTGGAGGG - Intronic
906757135 1:48329571-48329593 ACTTGTGTTTAAAAGTGGGCGGG + Intronic
907039587 1:51246485-51246507 GCTTGAGCTCAGGAGTTGGAAGG + Intronic
908200596 1:61791031-61791053 ACTTGTGGTTTGAAGATGGAGGG - Intronic
909732632 1:78913618-78913640 ACTTGAGTGTAGAAGATGGAAGG + Intronic
913203621 1:116516109-116516131 GCTTGAGTTTAGGAGTTAGTGGG - Intronic
919246264 1:194989249-194989271 GCTTGTGTTTAGAATCGGTAGGG - Intergenic
921403223 1:214749465-214749487 GTTTGTGTTTAGAAGTTAAGGGG + Intergenic
921431611 1:215072527-215072549 GCTTCTCTTGAAAAGTTGGAAGG + Intronic
921866209 1:220090369-220090391 GCTTGAGCCTAGAAGTGGGAAGG - Exonic
922506357 1:226128210-226128232 GCTTGAGTTTTGGAGCTGGAAGG + Intergenic
923278886 1:232422537-232422559 GATTTTGTTTATAATTTGGAGGG - Intronic
923544126 1:234911988-234912010 GCTTGTGTGTGGAAGGCGGAGGG + Intergenic
1063373829 10:5539838-5539860 CCATGTGTTAAGAAGTGGGATGG + Intergenic
1067442551 10:46317696-46317718 GCATGTGTTTTGGGGTTGGAGGG - Intronic
1067529621 10:47060741-47060763 GCTTGTGTCTGGATGTGGGAAGG + Intergenic
1067710407 10:48646771-48646793 GTTTGTTTCTAGAAGTTGTATGG - Intronic
1070312995 10:75287322-75287344 GCTTGTGTTCAGATATTGTAGGG - Intergenic
1073120249 10:101117970-101117992 TGTTGTGTTTAGCAGTTTGATGG + Intronic
1073853283 10:107645843-107645865 GCTTGTCCTTAGATGTGGGAGGG + Intergenic
1074873164 10:117593786-117593808 GCTGGTATATAGAAGGTGGATGG + Intergenic
1076286337 10:129300907-129300929 GCTTGTGCCTAGGAGGTGGAAGG - Intergenic
1079095295 11:17506008-17506030 GCATGTGTGTAGAAGTAGCATGG - Intronic
1082649623 11:55773225-55773247 GCTTCTGTTCAGAAGGTTGATGG + Intergenic
1083683686 11:64363141-64363163 GCTTTTGTTTAGATGTCAGACGG - Intronic
1084144091 11:67254772-67254794 GCTTTTGTTTAGCATTTTGAAGG + Intronic
1085016724 11:73178703-73178725 GCTTGTGTGTATAAGCTTGAGGG + Intergenic
1086326190 11:85702402-85702424 GCTTGAGTCCAGGAGTTGGATGG - Intronic
1086894145 11:92292928-92292950 GCTTGAGCCTAGGAGTTGGAGGG + Intergenic
1089288397 11:117422281-117422303 CCTTGTGAGTAGAAGTTGGAGGG + Intergenic
1090278161 11:125433899-125433921 GCATCTGTTTAGAAGCAGGAAGG + Intergenic
1096262414 12:50101099-50101121 GCTTCTGTTTAGATGTGGGCAGG + Intergenic
1096705588 12:53419822-53419844 GCTTGTGTGTTAAAGGTGGAAGG - Intergenic
1098073529 12:66701112-66701134 GTTTGTGTTTATTAGTTGCACGG - Intronic
1098368199 12:69728776-69728798 GCATGTGTTTTGAACTTGAAAGG + Intergenic
1099767699 12:87009782-87009804 GCATGGGATTAGAAGTTGGCAGG + Intergenic
1101941114 12:109099773-109099795 TCTTGTGTTCAGAAGTTCGTGGG + Intronic
1104753554 12:131255039-131255061 GCTTGAGCTTAGGAGGTGGAGGG - Intergenic
1105577473 13:21667677-21667699 GCTTTTGTTTAGGAGCTGTAAGG - Intergenic
1105624837 13:22102797-22102819 GCTTGAGTTTGGCATTTGGAAGG - Intergenic
1107028497 13:35827218-35827240 GCTTGTTTTTACAAGATGGCTGG + Intronic
1107106053 13:36643985-36644007 GCTTGTGTTTGAGAGGTGGAAGG - Intergenic
1109550986 13:63899908-63899930 GCATGTGTTTGGAAGTGTGAAGG + Intergenic
1109575238 13:64248050-64248072 GCTTGTGTTTTTAAGTTAAATGG + Intergenic
1110188221 13:72700192-72700214 GCTTGAGCCTAGGAGTTGGAGGG - Intergenic
1112581941 13:100683902-100683924 ACTAGTGGGTAGAAGTTGGAAGG + Intergenic
1115992528 14:39164617-39164639 GCTTGAGCTTAGGAGTTCGAGGG + Intronic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1117155973 14:52941961-52941983 GTGTGTGTTTGGAAGTTGGCGGG + Intronic
1119569454 14:75657466-75657488 GAATGTGTTAAGAAGTTGGCTGG - Exonic
1120721892 14:87898396-87898418 GCTTGTGTGTAAAAGTAGGTAGG - Intronic
1121048802 14:90806502-90806524 TCTTGTGTGTGGAAGTAGGATGG - Intronic
1122547577 14:102532683-102532705 GCTTGGGTTTAAAAGTTGCCTGG + Intergenic
1124146913 15:27136503-27136525 GCTTCTGTTTAAAAGTGTGAGGG + Intronic
1124351400 15:28958171-28958193 ACTTGTGGGTAGAAGCTGGAAGG + Intronic
1125275806 15:37990435-37990457 TCTTGTGGTTACAAGTTGTATGG + Intergenic
1126274057 15:46855593-46855615 GCTTGAGTTTAAAAGGTGAATGG + Intergenic
1126587685 15:50305862-50305884 GCTTGAGCTCAGAAGTTTGAAGG - Intronic
1126607212 15:50490367-50490389 GCTTGGCTTTATGAGTTGGAGGG - Exonic
1126670214 15:51109492-51109514 GCTTGTGGTTAGGTCTTGGATGG - Intergenic
1126893027 15:53226711-53226733 GCTTGGGCTTTGATGTTGGAAGG + Intergenic
1127368440 15:58312854-58312876 GCTTCTGTTGGGAAGTAGGAAGG + Intronic
1129104582 15:73297222-73297244 GCATGTGTGTGGAAGTCGGAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130369268 15:83270098-83270120 GCTAGTGGGTAGTAGTTGGAGGG + Intronic
1132122145 15:99185170-99185192 CCTTTTGTTTAGAATTAGGAAGG - Intronic
1136454352 16:30371880-30371902 GAGGGCGTTTAGAAGTTGGAAGG - Intronic
1137225604 16:46504610-46504632 GTCTGTGTTTAAATGTTGGAAGG - Intergenic
1148498944 17:48074296-48074318 GATTGTATTTAAAATTTGGAAGG - Intronic
1154360225 18:13654561-13654583 GCTTAGCTTCAGAAGTTGGAGGG - Intergenic
1157373681 18:47142585-47142607 GCTTCTATTTAGAAGTGTGAGGG + Intronic
1157675130 18:49562897-49562919 GCTTGTGCTTAGAAGCTGCCGGG + Intronic
1158044723 18:53142297-53142319 GCCTGTGTTTGGAAGTCGGGTGG + Intronic
1158642438 18:59214978-59215000 ACTTCTGTGTACAAGTTGGAAGG + Intergenic
1161514737 19:4690118-4690140 GCTTGGGTTCAGAAGTGGCAGGG + Intronic
1162853726 19:13451932-13451954 GCTTGAGCTCAGGAGTTGGAGGG - Intronic
1162881516 19:13663184-13663206 GGTTGGGTTTGGAAGATGGATGG - Intergenic
1163419166 19:17204541-17204563 GTGTGGGTTTAGAAGTTGGCAGG + Intronic
1165782341 19:38441785-38441807 TCTTGAGTTTAGGAGTTGGACGG + Intronic
925044444 2:761410-761432 ACTTGTGTTCAGGATTTGGAGGG - Intergenic
926474167 2:13301869-13301891 GCTAGCATTTATAAGTTGGAAGG + Intergenic
927162453 2:20279871-20279893 GCTAGTGCTTAGAAATAGGAAGG - Intronic
929240415 2:39647909-39647931 GCTGGTGTTGGGGAGTTGGAGGG - Intergenic
930881933 2:56280071-56280093 CCTTGTGTTTAGAGGTGGGGGGG - Intronic
931057655 2:58490827-58490849 TCTTGTGTTCAGTAGTTGAAGGG - Intergenic
934532446 2:95102075-95102097 ACTTGAGTTTAGGAGTTTGAGGG + Intronic
935825830 2:106948315-106948337 GCTTTTATTAAGAAGCTGGAGGG - Intergenic
937933339 2:127222149-127222171 GCTTGAGCCCAGAAGTTGGAAGG - Intergenic
938313558 2:130311086-130311108 GCTTCTGTTTAGAACTTGTCTGG + Intergenic
938676092 2:133635640-133635662 GCTTGTCTTTAGAAGTTACGAGG - Intergenic
938770082 2:134494162-134494184 TATTCTGTTTAGAAGTTGGTAGG + Intronic
939239688 2:139541866-139541888 GCTAGTGTCCAGCAGTTGGAAGG + Intergenic
940236485 2:151516402-151516424 GCTTGTGTTCAGTAGTGTGATGG + Intronic
940384266 2:153052095-153052117 GCTTTTGACTAGAAGCTGGATGG + Intergenic
942552632 2:177135382-177135404 TCTTGTGTGTAGAATATGGAGGG - Intergenic
942990689 2:182197922-182197944 GCTTATTTGTAGAAGTTGAAAGG - Intronic
945876605 2:215284481-215284503 TCTTGAGTCCAGAAGTTGGAGGG + Intergenic
946502333 2:220262899-220262921 GCCTGTTTTTACAACTTGGATGG - Intergenic
947314336 2:228839168-228839190 GTTTCTGTTTAGAAGTTTAAGGG + Intergenic
947653050 2:231803384-231803406 GCATGTGTTGAGGAGTGGGAAGG + Intronic
1169627185 20:7584244-7584266 GCCTGTGCTTAGAAGTAGTAAGG - Intergenic
1169684854 20:8260161-8260183 GCTTGAGTCTAGGAGTTTGAGGG - Intronic
1170795626 20:19544484-19544506 GCTTGTGTACAGATGTGGGAGGG + Intronic
1173945943 20:46951067-46951089 GCTGCCGTTTGGAAGTTGGATGG + Intronic
1177061675 21:16383309-16383331 GCCTGTGTTTAAAATTTAGAGGG + Intergenic
1177451302 21:21270657-21270679 GCTTTTGTTTTGAAAATGGAGGG - Intronic
1177709281 21:24750810-24750832 TCTTGTGTTTTGATGTTAGAGGG + Intergenic
1181012899 22:20052723-20052745 GCTTGTGCTTGGGAGTGGGATGG + Intronic
1181961202 22:26622974-26622996 GATTGTCTTGAGAAATTGGAAGG + Intronic
1185168138 22:49274906-49274928 GCCTGTGTGTAGGATTTGGAAGG + Intergenic
950002037 3:9664130-9664152 GCTTGTCATTAGAGGTTGCACGG + Intronic
950028540 3:9836742-9836764 GCTTGAGTCCAGGAGTTGGAGGG + Intronic
953763852 3:45717528-45717550 GGTACTGTTTTGAAGTTGGATGG + Intronic
955836482 3:63061171-63061193 TCCTGTGTTTAGAGTTTGGAGGG + Intergenic
955992777 3:64645817-64645839 GCTTGTGTTTAGCAGGAGCAGGG + Intronic
958502560 3:94933241-94933263 GATTGTCATTAGAAGGTGGATGG + Intergenic
960534922 3:118804992-118805014 ATTTGTGTTTTGAAGTTGGAAGG + Intergenic
962805958 3:138928039-138928061 GTTAGTGGTTAGACGTTGGATGG + Intergenic
963436082 3:145267972-145267994 GATTGTGTTTGAAAGTTTGAGGG + Intergenic
965868870 3:173241775-173241797 GATTGAGTTTTTAAGTTGGATGG + Intergenic
968885563 4:3329295-3329317 TGGTGTGTTTAGAACTTGGAGGG + Intronic
969446729 4:7249151-7249173 GCTTGTGTTCAGATGGTGGCTGG + Intronic
972581943 4:40402942-40402964 GCTTGTGTTTCCTGGTTGGAGGG - Intergenic
974011509 4:56611858-56611880 GCTTGTGTGGGGAAGTTGAAGGG - Intergenic
976796900 4:88944267-88944289 TCTTGAGCTTAGAAGTTTGAAGG + Intronic
977177885 4:93838089-93838111 TTTTGTGTTTAGAATTGGGATGG - Intergenic
980098532 4:128518380-128518402 GCTTGCTCCTAGAAGTTGGAAGG + Intergenic
981007927 4:139894674-139894696 CCTTGTGTTCAGCAGTTCGAGGG - Intronic
981182499 4:141762852-141762874 GCCTGTGTTAAAAAGTTGGCAGG - Intergenic
982933816 4:161444178-161444200 AATTGTGTTTAGAAGTTGAGAGG + Intronic
983185876 4:164699987-164700009 GCTTGTGTGTTGAGGGTGGAGGG + Intergenic
983722163 4:170868876-170868898 GCTTGTGTTTTGAAGGTGCTGGG - Intergenic
984371898 4:178878153-178878175 GCATGTGTTTCTAAGTTAGAAGG - Intergenic
984402464 4:179284706-179284728 GCTTACGTTTAGAAATTGGAAGG + Intergenic
987379282 5:17269622-17269644 GCTTGGTTTTATAAGGTGGAAGG + Intronic
987877724 5:23700840-23700862 GCTTGTTTTTAGAATTATGATGG + Intergenic
989285742 5:39697630-39697652 GATAGTGTTAAGAAGCTGGAAGG - Intergenic
990521664 5:56587176-56587198 GCTTGGGTGTAGGAGTTGGTTGG - Intronic
992610055 5:78499886-78499908 GCTTCTTTCTAGAAGTTGGTCGG - Intronic
993339438 5:86705004-86705026 AATTGTGTTTAGGAATTGGAGGG + Intergenic
994851693 5:105063024-105063046 ACTGGTGTTTAGAAGCTGGCAGG + Intergenic
995478710 5:112573798-112573820 GATTGTGTTTAGCAGGAGGAAGG - Intergenic
996708586 5:126521979-126522001 GCTTGAGCTGAGAAGTTCGAGGG - Intergenic
997652662 5:135534058-135534080 CCTTGTGTTTACAAGGTGAAAGG + Intergenic
997910696 5:137870228-137870250 GCTTGTGCCCAGGAGTTGGAGGG + Intronic
998448034 5:142213243-142213265 ACTTGAGTCTAGGAGTTGGAGGG + Intergenic
998973323 5:147616325-147616347 ACATTTGTTTAGAAGATGGATGG + Intronic
999848128 5:155507653-155507675 GTTTGTGTTAAGAAGGTGGATGG - Intergenic
1001799630 5:174531827-174531849 GGGTGTGTTTAGAAGCTTGAAGG - Intergenic
1003639939 6:7868267-7868289 GATTTTGTTTATAATTTGGATGG - Intronic
1005260586 6:24055043-24055065 GACTGTGTTTAGGAGTTTGAGGG - Intergenic
1005385952 6:25284391-25284413 ACTTGTTTTAACAAGTTGGATGG - Intronic
1006043911 6:31277480-31277502 GCTTGCCTTTATGAGTTGGAGGG - Intronic
1007253333 6:40511303-40511325 GCCTTTGATTAGAAGATGGATGG + Intronic
1007802720 6:44411175-44411197 GCCTGTGTCTAGAAGTGGGTGGG + Intronic
1008258150 6:49330260-49330282 GAGTGTGTTTGGAAGGTGGACGG - Intergenic
1009056122 6:58337425-58337447 CATTGTGTTTAGAAGTTGCTAGG - Intergenic
1009235059 6:61113174-61113196 CATTGTGTTTAGAAGTTGCTAGG + Intergenic
1009892030 6:69696501-69696523 GGTTTTGTTTAGGGGTTGGAGGG - Intronic
1010284831 6:74064265-74064287 TCTTGTGCATTGAAGTTGGAGGG - Intergenic
1011131712 6:84058681-84058703 GCTTGTGTTTAGAAGTTGGAGGG + Intronic
1012065923 6:94552249-94552271 GCTTGTGTTTAGATGGTTAAAGG + Intergenic
1012349309 6:98231834-98231856 GCATGTGTTTACAAGGTGGCAGG + Intergenic
1012472486 6:99587952-99587974 GCTTGTTTTTAATTGTTGGACGG + Intergenic
1012743327 6:103049221-103049243 GCTTTTATTTAGAAGTTTGTTGG + Intergenic
1013970502 6:116012300-116012322 GCTTGTGTCCAGATGGTGGAAGG - Intronic
1017052268 6:150404376-150404398 GTTTGTGATTTGAAGTTGAAAGG + Exonic
1020982973 7:15095235-15095257 GTTTGGGTTTCTAAGTTGGAAGG + Intergenic
1020997200 7:15279567-15279589 GTTTGTCTTTCCAAGTTGGAGGG - Intronic
1022662656 7:32381155-32381177 GCTTGTATTTTGAAGGTAGAGGG - Intergenic
1023148041 7:37171863-37171885 GATGGTGTTTAGAAGTTGATGGG - Intronic
1025028719 7:55538450-55538472 GCTTGTGTTTAGATTTTGAGAGG - Intronic
1025974466 7:66358905-66358927 GCTTGTGTGTGGAGGTTGGGAGG + Intronic
1026473586 7:70715290-70715312 GTTTGTGTTTATCAATTGGAGGG + Intronic
1031166039 7:118228297-118228319 GCTGGAGATTAAAAGTTGGAAGG - Intronic
1032182842 7:129695757-129695779 CTGTGTGTTTAGAACTTGGAGGG + Intronic
1035165051 7:156984353-156984375 GCTTGTTTTTCCAAGTTGTATGG - Intergenic
1037433504 8:18839285-18839307 GTTTGTGTCTAAAAGTTCGATGG - Intronic
1038127460 8:24690680-24690702 GCCTGTGTTTAGAAGAAGCATGG + Intergenic
1039032988 8:33330015-33330037 GCTGGTGTTTAGCAATTAGAGGG + Intergenic
1039392133 8:37189808-37189830 GCTTGAGTGCAGAAATTGGAGGG + Intergenic
1039898581 8:41734191-41734213 GAGTGTGTCTAGAGGTTGGAAGG + Intronic
1041131627 8:54708173-54708195 GTTTGTGTTTGGAAGTTGCTGGG + Intergenic
1041562233 8:59231887-59231909 GTCTGTGTTTAAATGTTGGAAGG - Intergenic
1042114504 8:65415706-65415728 GCTTGTTTCTAGAAATGGGAGGG + Intergenic
1043028479 8:75102152-75102174 AATTATATTTAGAAGTTGGAAGG - Intergenic
1044234865 8:89819045-89819067 ACTTGAGCTTAGCAGTTGGAAGG + Intergenic
1044919059 8:97148768-97148790 GCTTGGGGTTAGAAGTAAGATGG - Intronic
1047834080 8:128669239-128669261 GGTGGAGTTTAGAAGTTGAAAGG + Intergenic
1049872578 8:144992451-144992473 GCTTCAGTATAGAAGTGGGAAGG + Intergenic
1051925002 9:22314661-22314683 GCTATGGTTTGGAAGTTGGAGGG - Intergenic
1055967989 9:81883873-81883895 GCTTGGGTTCAGCAGTGGGAAGG + Intergenic
1056004526 9:82254345-82254367 GCTTGGGTTTTGAAGTTATAAGG + Intergenic
1058621462 9:106887906-106887928 GCTTGTCTTTGGAAGTAGAAAGG - Intronic
1058925230 9:109656554-109656576 GCTTTTGTTTAGATGATGAAAGG + Intronic
1059109837 9:111545575-111545597 GCCTGGGATTAGAGGTTGGACGG - Intronic
1059586413 9:115612311-115612333 GCTTGTGATTGGAAATGGGAGGG - Intergenic
1061282419 9:129605030-129605052 GCTTGTGTACAGCATTTGGAAGG - Intergenic
1187968258 X:24634004-24634026 GCTTGTACTTAGGAGTTGGAGGG - Intronic
1188258305 X:27989481-27989503 GATTATGTTTAGAAGTTGGTGGG - Intergenic
1188678713 X:32975513-32975535 GATTTTGTTTAGAAGTAGCAAGG + Intronic
1189635222 X:43000569-43000591 GCTTGGGTATAGAAGTTTGTTGG + Intergenic
1190846843 X:54200732-54200754 GCTTTTGTTGACTAGTTGGAGGG - Intronic
1191718800 X:64211944-64211966 GTTTGTTTTTACAAGATGGAAGG + Intergenic
1194617972 X:96130864-96130886 GCTTATGTTTAGAAACTGAAGGG - Intergenic
1196418607 X:115499747-115499769 GCTTGATTTTAGAACTGGGAAGG - Intergenic
1198541803 X:137648052-137648074 TCCTGTGTTTAGAGGATGGAGGG - Intergenic
1199825757 X:151497976-151497998 GGTTGTCTTTGGAACTTGGAAGG - Intergenic