ID: 1011132504

View in Genome Browser
Species Human (GRCh38)
Location 6:84065864-84065886
Sequence GAATCCCTTTTGGCTTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011132504_1011132508 -3 Left 1011132504 6:84065864-84065886 CCTCCTCAAGCCAAAAGGGATTC 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1011132508 6:84065884-84065906 TTCTACCAGGACACTGCCTTTGG 0: 1
1: 0
2: 5
3: 43
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011132504 Original CRISPR GAATCCCTTTTGGCTTGAGG AGG (reversed) Intronic
900029207 1:358790-358812 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
900049809 1:587562-587584 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
900967424 1:5968512-5968534 GAATCGCTTGAGGCTGGAGGCGG + Intronic
903047317 1:20574619-20574641 GAAGGCCTTTTGGCCTGAGGAGG - Intergenic
904622552 1:31783981-31784003 GCCACCCTTTGGGCTTGAGGAGG - Intergenic
905679016 1:39853481-39853503 GGATCACTTGAGGCTTGAGGCGG - Intronic
906380942 1:45331872-45331894 AAAGCCCTCTTGGCTTGAGTAGG - Intronic
907756939 1:57319697-57319719 GACTCCCTTCTGGCTAGAAGTGG + Intronic
907770449 1:57457167-57457189 GAGACCCTTCTGCCTTGAGGAGG + Intronic
908193935 1:61730133-61730155 GAATCCATTTTGGTTTGATCTGG + Intergenic
912936786 1:114010641-114010663 GAATCCCCTTTTGAATGAGGAGG + Intergenic
913012394 1:114697280-114697302 GAATCCTTTGTGGCTAGAAGCGG + Intergenic
914874324 1:151501499-151501521 GAATCCCTTTTTTTTTGAGATGG - Intergenic
917727628 1:177842493-177842515 GAAGCCCTTTTGGGTTGATGTGG - Intergenic
921416996 1:214900098-214900120 GAATGCCTTTGGGCTTAAGGTGG - Intergenic
923586299 1:235275540-235275562 AACTCCAGTTTGGCTTGAGGAGG - Intronic
1064001177 10:11664839-11664861 AATTCCCTTTTGCTTTGAGGCGG - Intergenic
1066272303 10:33835756-33835778 GCATCCATTTGGGCTTAAGGTGG + Intergenic
1069938570 10:71937313-71937335 GACTCCCTTCAGTCTTGAGGTGG - Intergenic
1070803128 10:79255096-79255118 GATTCCCTCTGGCCTTGAGGAGG + Intronic
1073481573 10:103789232-103789254 GCATTCCCTTTGGCTTGTGGGGG - Intronic
1074509349 10:114098925-114098947 GAGTCCCTTCTGGCTTGGGTGGG - Intergenic
1075227299 10:120641107-120641129 GAATCCCTTTAGGCGTGAAGAGG - Intergenic
1076338656 10:129727952-129727974 CAATCCCTTCTGGCTGGAGCAGG + Intronic
1076471667 10:130723348-130723370 GAATCCCTTTGGCCAAGAGGAGG + Intergenic
1078925576 11:15871903-15871925 GGCTCCCTTTTGGTTTGAGGAGG + Intergenic
1079209833 11:18450997-18451019 GTATCCCTTGTGTCTTGGGGCGG + Exonic
1080436659 11:32250972-32250994 GAATCCCTTTTAGAATGAGCAGG - Intergenic
1080698633 11:34624945-34624967 CAAACCCTTTTGCCTAGAGGAGG - Intronic
1081025568 11:38009404-38009426 GAGACACTTTTGGCTTTAGGTGG - Intergenic
1088261508 11:107948499-107948521 GAATCCCTCTCGGCTGGGGGTGG - Intronic
1089827205 11:121289230-121289252 GAATCCCTTTGGCCAAGAGGTGG + Intergenic
1090646270 11:128768875-128768897 GGATTCCTTTTGGGTGGAGGCGG - Intronic
1092319823 12:7460390-7460412 GATTCCCTTTTGGCCTGGGGTGG - Intronic
1099807843 12:87542923-87542945 GATTCCCTTCTGGCTAGAGCTGG - Intergenic
1105338148 13:19494081-19494103 GAATCCTGTTTGGAGTGAGGAGG - Intronic
1106060128 13:26282379-26282401 AAATCCCTTCTGGCTTGTAGGGG - Intronic
1110669857 13:78165090-78165112 GCCTCCCTTTTGGTTAGAGGAGG + Intergenic
1116530834 14:45971456-45971478 GAATTCCTTCTTGCTTGAGGAGG - Intergenic
1117951791 14:61090165-61090187 GAATTCCTTTTGGATTGACATGG + Intergenic
1121910178 14:97782903-97782925 CAATCCCTTTTGGCTTCAAAGGG + Intergenic
1123757581 15:23408842-23408864 GTTTCCCTTTAGGCTTTAGGGGG + Intergenic
1126189485 15:45864833-45864855 GAATCACTTTTGTCCTAAGGTGG - Intergenic
1126606395 15:50481078-50481100 GAATCCGTTTTGGCTGTATGGGG + Intronic
1131021846 15:89105817-89105839 CCATCCCTTCTGGCTTGAGGTGG + Intronic
1133222492 16:4324802-4324824 TAATCCCATTTGGGATGAGGGGG + Intronic
1134572412 16:15302519-15302541 GATTCACTTTTGGTTTGAAGAGG - Intergenic
1134729969 16:16453522-16453544 GATTCACTTTTGGTTTGAAGAGG + Intergenic
1134937464 16:18258378-18258400 GATTCACTTTTGGTTTGAAGAGG - Intergenic
1135903668 16:26490464-26490486 AAATCCCTTTTGGAATGAGATGG - Intergenic
1139606144 16:68020061-68020083 GCATCCCTCTTGTCTTGTGGGGG + Intronic
1140041144 16:71409077-71409099 TGATGCCTTTTGGCTTTAGGCGG - Intergenic
1142328497 16:89434207-89434229 GAATCCATAGTGTCTTGAGGAGG - Intronic
1143068441 17:4268261-4268283 GAACCCTTTCTGCCTTGAGGAGG - Intergenic
1143413598 17:6728540-6728562 GATTCCCCTTTGGCTAGGGGTGG - Intergenic
1147725050 17:42561901-42561923 GATTCCCTTCTGGCCTGATGAGG - Intronic
1148444953 17:47732008-47732030 TAATCCTGTTTGGCTTTAGGGGG + Intergenic
1150604400 17:66678558-66678580 GAATGCCTGTTGGCTTAAGTAGG - Intronic
1152950551 17:83227766-83227788 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1157168967 18:45384626-45384648 GAATACCTTTTGGTTGGGGGCGG - Intronic
1158515352 18:58126053-58126075 GACTCCCTTTAGCCTTGAAGGGG + Intronic
1158827986 18:61245531-61245553 GAAACCCCTTTGGCAGGAGGAGG + Intergenic
1160785235 19:897315-897337 GAAACCTTTTTCGCTTGGGGTGG - Exonic
1162018868 19:7859767-7859789 GCCTCCCTTTGGGCCTGAGGAGG - Intronic
1162666727 19:12219969-12219991 GAACTCCTTGTGGCTTGGGGCGG - Intergenic
1163219076 19:15901407-15901429 GGATCCCTCATGGCTTGATGTGG + Intergenic
1164633751 19:29778080-29778102 GAAGCCCTTTTTGTTTGAGATGG + Intergenic
1166070646 19:40385374-40385396 GAGACCCTTGTGGCTGGAGGAGG - Intronic
1168722387 19:58561277-58561299 GAAGCCCTGTGGGCCTGAGGGGG - Intergenic
925094747 2:1187407-1187429 GAATCCCTTCTTGCTTGGTGAGG - Intronic
927116123 2:19903588-19903610 GAATCCCTTCTGGGTGGAAGTGG + Intergenic
928404035 2:31000630-31000652 GAATTCCTTCTTGCTTGGGGAGG + Intronic
930972015 2:57407943-57407965 GATTCCCCTCTGGCTAGAGGAGG - Intergenic
932614098 2:73220995-73221017 GCATCCCTATTGGCTTAATGGGG - Intronic
932943079 2:76192903-76192925 GTATCCCTTTTGGAATGAGTAGG - Intergenic
936941373 2:117887780-117887802 GAATCCCTTTTGCCTAGTGTTGG + Intergenic
938558563 2:132449332-132449354 GAATCCCTTGAACCTTGAGGCGG - Intronic
939038438 2:137160485-137160507 GAATACCGTTAGGCTTGAGCTGG - Intronic
942334852 2:174872277-174872299 GGATCCTTTTTTGTTTGAGGTGG - Intronic
942928328 2:181458465-181458487 GAATCCCTTTTATATTAAGGAGG - Intronic
943349558 2:186781138-186781160 GACTCCTTTTTGGCTCTAGGTGG - Intergenic
943888166 2:193249563-193249585 GAATCCATTTTGACTTCACGGGG - Intergenic
944287329 2:197966445-197966467 GATTCCCTTTTGGCTAGGGCTGG + Intronic
945941300 2:215953478-215953500 GCCTCTCTTTTGGCTTGAGTTGG - Intronic
946186576 2:217984046-217984068 GAATTCCTTCTTGCTTGGGGAGG - Intronic
946587119 2:221202105-221202127 GATTCCCTTTTGGCCTGGTGAGG - Intergenic
1170161193 20:13313031-13313053 AAATGCCTTTTAGCTCGAGGGGG - Intergenic
1170401628 20:15991140-15991162 GAATGCCTTTTAGCTCAAGGTGG + Intronic
1176255396 20:64149442-64149464 GAAGCCTTCTTGGTTTGAGGAGG + Intergenic
1176735417 21:10541787-10541809 GAATCCTGTTTGGAGTGAGGAGG + Intronic
1177197812 21:17921225-17921247 GAATTCCCTCTTGCTTGAGGAGG + Intronic
1181185265 22:21098849-21098871 GAATCCCTTTTACCAGGAGGTGG - Intergenic
1183142437 22:35955587-35955609 GAATGCCTGATGACTTGAGGTGG - Intronic
1183533717 22:38381576-38381598 GAATCCTGTTTGGAGTGAGGAGG - Intronic
1184553911 22:45222141-45222163 GAATTTATTTTGGCTTGAGCAGG - Intronic
1185211383 22:49572675-49572697 GAATTCCTTCTTGCTTGGGGAGG - Intronic
950555502 3:13693405-13693427 GATGCCCTTCTGGCTAGAGGTGG + Intergenic
951249311 3:20375749-20375771 AGATCCCTTTTGGCTTGAATTGG + Intergenic
953468982 3:43150717-43150739 GAATCCATGTTGGCTGGAAGGGG + Intergenic
953611453 3:44450711-44450733 GAAGACCTCTGGGCTTGAGGGGG + Intronic
958083322 3:88774626-88774648 GAATCCCCTTTGGCTTGAGCTGG - Intergenic
961208724 3:125108827-125108849 GAATCACTGGTGGCTGGAGGAGG + Intronic
962421280 3:135231085-135231107 GCATCCCTTCTGCCCTGAGGAGG - Intronic
962749629 3:138424361-138424383 GACCCTCTTTTGACTTGAGGAGG - Intergenic
963413274 3:144960133-144960155 GGATCCCTTGTGGCTTGGTGTGG - Intergenic
965016714 3:163167809-163167831 GTATTCCTTTTGGCCTGGGGTGG - Intergenic
968932018 4:3586012-3586034 GAATTCCTTTTTTCTTGAGTCGG + Intronic
970763020 4:19514615-19514637 GCCTCCCTTTTGGCTTGGAGTGG + Intergenic
973722775 4:53742085-53742107 GAAACTCATTTGGCTTAAGGGGG + Intronic
976004624 4:80414625-80414647 GAATCTCTTTTATCTTGAGGAGG - Intronic
977635052 4:99287605-99287627 GAAACCCTTTTCCATTGAGGAGG - Exonic
977640092 4:99347786-99347808 GAAACCCTTTTCCATTGAGGAGG - Exonic
980620349 4:135293716-135293738 GAATCCTTTTTGGCTCTAGGTGG + Intergenic
982326058 4:154129146-154129168 GAATCCCTTGTGGGGTGATGAGG + Intergenic
983166054 4:164478248-164478270 GATTCCCCTCTGGCTAGAGGTGG + Intergenic
984755846 4:183324888-183324910 GGCTACCATTTGGCTTGAGGTGG - Intergenic
985764105 5:1767962-1767984 GCCTCCCTTTTGGGGTGAGGAGG - Intergenic
989944147 5:50197209-50197231 GAGACCCTTTCGGCCTGAGGTGG - Intergenic
991626643 5:68609461-68609483 GAATCCTTTTTGGCCAGATGCGG - Intergenic
994147929 5:96415288-96415310 GAATCCCCTTTGCCTAGAAGTGG + Intronic
996595065 5:125191308-125191330 GAATTCCTTTTTGCTAGTGGGGG + Intergenic
998296178 5:140971094-140971116 GAAGCCCTTTGGGATTGGGGTGG + Intronic
999513806 5:152280391-152280413 GGATCCCTTTTGACTAGAGCTGG - Intergenic
1002744783 5:181461581-181461603 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1003480339 6:6525375-6525397 GTGTGCCTGTTGGCTTGAGGGGG - Intergenic
1004994843 6:21180078-21180100 CAATGCCCTTTGGGTTGAGGTGG - Intronic
1008715751 6:54288016-54288038 GACTCCCTTATGGCTGGATGAGG + Intergenic
1010320626 6:74504719-74504741 GATTCCCTACTGGCTTGAGGTGG - Intergenic
1011014254 6:82737055-82737077 GAATTGCTTATGGCTTGATGTGG - Intergenic
1011132504 6:84065864-84065886 GAATCCCTTTTGGCTTGAGGAGG - Intronic
1011319812 6:86079139-86079161 GAATCCCTTCTAGCTTGTAGGGG + Intergenic
1012850659 6:104442953-104442975 GCTTCCCTTTTGGGTTGAGTTGG - Intergenic
1017676678 6:156821356-156821378 CAATACCTTTTGTGTTGAGGGGG + Intronic
1019249694 6:170735122-170735144 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1022376869 7:29822267-29822289 GAATTCTTTTTGGCTTAGGGAGG + Intronic
1033320317 7:140333204-140333226 GGATCGCTTTTGACTTCAGGAGG + Intronic
1033734571 7:144208933-144208955 GAATGCCTTTGGCCTAGAGGAGG + Intergenic
1033748481 7:144342036-144342058 GAATGCCTTTGGCCTAGAGGAGG - Intergenic
1034393869 7:150805142-150805164 GAATTTCTCTTGGCTGGAGGAGG + Intergenic
1034577172 7:152010399-152010421 GAAGCACTTTTGGCTGGACGCGG - Intronic
1035498402 8:72534-72556 GAATCCCTTTGGCCCAGAGGCGG + Intergenic
1035649579 8:1254723-1254745 AAATCCCTTTTGGGTTTCGGGGG + Intergenic
1036153130 8:6316965-6316987 GAATTCCTTTCTGCTTGGGGAGG - Intergenic
1039384090 8:37116546-37116568 GAATTCCCTCTTGCTTGAGGAGG - Intergenic
1040313212 8:46247502-46247524 GATTCCATTTTTGCTTGTGGAGG - Intergenic
1040324468 8:46334730-46334752 GACTTCCTTTTCGCTTGTGGGGG - Intergenic
1042004090 8:64161551-64161573 TCATCCCTTTTTACTTGAGGTGG + Intergenic
1044779718 8:95731748-95731770 GAATCCCTTTGGACTTAAAGGGG - Intergenic
1046410048 8:113830299-113830321 GAATTCCCTCTTGCTTGAGGAGG - Intergenic
1046596839 8:116271330-116271352 CAATCTCTTTTGGCTTGTAGGGG + Intergenic
1046690968 8:117283777-117283799 GAATCCTTTTTTTCTTAAGGTGG + Intergenic
1047693876 8:127384026-127384048 GTTTCCCTTTGGGCTTGATGAGG - Intergenic
1048692607 8:136984572-136984594 GAATCCCTTCTTGCTTGGGGAGG - Intergenic
1051648741 9:19298193-19298215 GTATACCTTTGGGTTTGAGGTGG + Intronic
1053062467 9:35043064-35043086 GTATCCCTATAGCCTTGAGGAGG - Exonic
1054723211 9:68624135-68624157 GGATCCCTTTTGGTGTTAGGGGG + Intergenic
1054794530 9:69287977-69287999 GAATGTCTTTTGGGTTTAGGAGG + Intergenic
1057955169 9:99401533-99401555 GAATCCCTATTGACTTCAGTAGG + Intergenic
1059403487 9:114085483-114085505 GAATCCCTTTGGTATTGGGGTGG + Intergenic
1203610594 Un_KI270748v1:92060-92082 GAATCCCTTTGGCCCAGAGGCGG - Intergenic
1189999633 X:46673504-46673526 GAATGGCTTATGCCTTGAGGAGG - Intronic
1191567116 X:62554182-62554204 GAGTCCTTTTTGGCTTATGGTGG + Intergenic
1192554285 X:72077713-72077735 GGATCCCTCTGGGCTGGAGGTGG - Intergenic
1193167830 X:78302192-78302214 TACACCCTTTGGGCTTGAGGTGG - Intronic
1193329884 X:80223919-80223941 GATTCCCTTTTGGCCTGTGGTGG + Intergenic
1193907498 X:87261013-87261035 GATTCCCTTTTGGCTAGGGCTGG - Intergenic
1194457684 X:94124455-94124477 GATTCCCTTTTGCCTAGAAGTGG + Intergenic
1194522175 X:94932252-94932274 GATTCCCCTTTGGCTAGAGCTGG + Intergenic
1194841931 X:98753790-98753812 GAATCCCTTTGGACTGGTGGTGG - Intergenic
1197117659 X:122852156-122852178 GATTCCTTTCTGGCTTGAGTTGG - Intergenic
1197581409 X:128288512-128288534 GAATTCCTCGTGGCCTGAGGTGG + Intergenic
1199495156 X:148444524-148444546 GAGTCCCTTTTGGAGTCAGGAGG + Intergenic