ID: 1011134187

View in Genome Browser
Species Human (GRCh38)
Location 6:84081908-84081930
Sequence CAATTTTAGTGGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1525
Summary {0: 1, 1: 0, 2: 8, 3: 162, 4: 1354}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011134187 Original CRISPR CAATTTTAGTGGAAGGCAGA GGG (reversed) Intronic
900041145 1:465498-465520 CAATCATGGTGGAAGGCAAAAGG + Intergenic
900062576 1:700474-700496 CAATCATGGTGGAAGGCAAAAGG + Intergenic
900708857 1:4098216-4098238 CAATAATAGTGGAAGGCAAAGGG + Intergenic
900760200 1:4465254-4465276 CAATCATGGTGGAAGGCAAAAGG - Intergenic
900773963 1:4567736-4567758 CAATCATGGTGGAAGGCAAAAGG - Intergenic
900835987 1:5004473-5004495 CAATCATGGTGGAAGGCAAAAGG + Intergenic
900981574 1:6048964-6048986 CGATTCTCCTGGAAGGCAGACGG + Intronic
901750934 1:11407911-11407933 CATTTTTCGTGGATGGCAGCAGG - Intergenic
901753470 1:11426591-11426613 CAATCATAGTGGAAGGCAAAAGG - Intergenic
902060492 1:13638082-13638104 CAATCATTGTGGAAGGCAAAGGG + Intergenic
902099217 1:13971900-13971922 CAATTATGGTGGAAGGCAAAGGG - Intergenic
902490681 1:16778627-16778649 CAATCATGGTGGAAGGCAGAGGG + Intronic
903527073 1:23999131-23999153 CAATCATGGTGGAAGGCAAAGGG - Intergenic
904278397 1:29399450-29399472 CAATCATGGTGGAAGGCAAAGGG - Intergenic
904544448 1:31257488-31257510 CAGTCATAGTGGAAGGCAGAGGG - Intergenic
904974308 1:34444081-34444103 CCATATTAGAGGAAGGCAGAGGG - Intergenic
904995476 1:34628163-34628185 CAATCATGGTGGAAGGCAAAGGG - Intergenic
905097950 1:35490943-35490965 CAATCATGGTGGAAGGCAAAGGG - Intronic
905230008 1:36509233-36509255 CAATCATGGTGGAAGGCAAAAGG + Intergenic
905361277 1:37422619-37422641 CAATTATGGTAGAAGGCAAAGGG + Intergenic
905569900 1:38995237-38995259 AAATTATAGTGGAATCCAGATGG + Intronic
905813671 1:40931439-40931461 CAATTATGGCGGAAGGCAAAGGG + Intergenic
906353867 1:45086097-45086119 CAATCATGGTGGAAGGCAAAAGG + Intronic
907259551 1:53207149-53207171 CAATCATGGTGGAAGGCAAAGGG - Intronic
907294657 1:53442628-53442650 CAATTATGGTGAAAGGCAAAGGG - Intergenic
907585536 1:55614010-55614032 CTATTTCAGTGGAAGCCAAAAGG + Intergenic
907597825 1:55735907-55735929 CAATTATGGTGGAAGGCAAAGGG + Intergenic
907625677 1:56026958-56026980 CAATCATGGTGGAAGGCAAAAGG - Intergenic
907807972 1:57840614-57840636 TAATCATGGTGGAAGGCAGAGGG + Intronic
908020120 1:59890404-59890426 CAATTGTAGTGGAAGGTGAAAGG + Intergenic
908469998 1:64434414-64434436 CACTCATAGTGGAAGGCAAAGGG - Intergenic
908476221 1:64491409-64491431 CAATCATGGTGGAAGGCAAAGGG + Intronic
908497499 1:64709265-64709287 CAATCATGGTGGAAGGCAAAGGG - Intergenic
908810191 1:67974299-67974321 CAATTAAGGTGGAAGGCAAAGGG - Intergenic
908816413 1:68039899-68039921 CAATCATGGTGGAAGGCAAAAGG - Intergenic
908820665 1:68083024-68083046 CAATCATGGTGGAAGGCAAAGGG + Intergenic
908838159 1:68249613-68249635 CAATCATAGCGGAAGGCAAAGGG + Intergenic
908934425 1:69357493-69357515 AAATCTTTATGGAAGGCAGAGGG + Intergenic
909023896 1:70461687-70461709 CAATCATGGTGGAAGGCAAAGGG - Intergenic
909084826 1:71158142-71158164 CAATTTTAGTGGAAATCATATGG + Intergenic
909149375 1:71981645-71981667 AAGGTTTAGTGGAAGGCATAAGG + Intronic
909189290 1:72531971-72531993 CAATCATGGTGGAAGGCAAAAGG + Intergenic
909192732 1:72574032-72574054 CAATCATGGTGGAAGGCAGGAGG - Intergenic
909634285 1:77798417-77798439 CAATTATGGTAGAAGGCAAAAGG + Intronic
909693620 1:78438822-78438844 CAATCATGGTGGAAGGCAAAGGG + Intronic
909744644 1:79078707-79078729 CAATCATGGTGGAAGGCAAAGGG - Intergenic
909755409 1:79219940-79219962 CAATCATGGTGGAAGGCAAAAGG - Intergenic
909959320 1:81819344-81819366 CTGCTTTAGTGGAAGGGAGAAGG + Intronic
910077249 1:83296013-83296035 CAATTTTGGTAGAAAGCTGAGGG - Intergenic
910101970 1:83586892-83586914 CAATTATGGTGGAAGGCAGCAGG + Intergenic
910192707 1:84610919-84610941 CAATCATGGTGGAAGGCAAAAGG - Intergenic
910258261 1:85271455-85271477 CAGTCTTGGTGGAAGGGAGATGG + Intronic
910355227 1:86345270-86345292 CAATTATGGTGGAAGGCAAAGGG + Intergenic
910715412 1:90224674-90224696 CAATCATGGTGGAAGGCAAAAGG - Intergenic
910731136 1:90398715-90398737 CAATCATGGTGGAAGGCAAAAGG + Intergenic
910773664 1:90853517-90853539 CAATAATATTGGAAGGCACAAGG - Intergenic
911274823 1:95848600-95848622 CAATTATGGTGGAAGGTAAAAGG - Intergenic
911346324 1:96700844-96700866 CAATCATGGTGGAAGGCAAAGGG - Intergenic
911501446 1:98690783-98690805 AAAATCTTGTGGAAGGCAGATGG + Intronic
911517337 1:98882537-98882559 CAATTGTGGTGTAAGGCAAAGGG - Intergenic
911630224 1:100175045-100175067 CAATCATGGTGGAAGGCAAAGGG - Intronic
911661405 1:100505893-100505915 CAATCATGGTGGAAGGCAAAAGG + Intronic
911754470 1:101537079-101537101 CAATCATGGTGGAAGGCAAAGGG - Intergenic
911779525 1:101858744-101858766 CAATTATAGTAGAAGGCAGAGGG - Intronic
911861158 1:102950995-102951017 CAATCATGGTGGAAGGCAAAGGG - Intronic
911894675 1:103417049-103417071 CAATCATGGTGGAAGGCAAAGGG + Intergenic
911982554 1:104584703-104584725 CAATTGTGGTGAAAGGCAAAGGG + Intergenic
912073024 1:105838367-105838389 CAATCATGGTGGAAGGCAAAGGG - Intergenic
912617004 1:111112350-111112372 CAATCCTGGTGGAAGGCGGAGGG - Intergenic
912883117 1:113438609-113438631 CAGTTATGGTGGAAGGCAAAGGG + Intronic
912974275 1:114313974-114313996 CAATCATGGTGGAAGGCAAAAGG + Intergenic
912974597 1:114316424-114316446 CAATCATGGTGGAAGGTAGAGGG - Intergenic
913142271 1:115953351-115953373 CAATTGTGGTGGAAGGCAGAGGG - Intergenic
915876036 1:159613030-159613052 CAATCATGGTGGAAGGCAAAAGG + Intergenic
916051898 1:161042221-161042243 GAAGTGTAGAGGAAGGCAGAGGG + Intronic
916220899 1:162444216-162444238 CAATCATGGTGGAAGGCAAAGGG - Intergenic
916508367 1:165448540-165448562 CAATCATGGTGGAAGGCAAAGGG - Intergenic
916571871 1:166035139-166035161 CAGCTTTAGAGGCAGGCAGATGG + Intergenic
916665002 1:166958492-166958514 CAATCATGGTGGAAGGCAAAGGG - Intronic
916773329 1:167935675-167935697 CCATTTTAGAGGAAGCGAGAAGG + Intronic
917148929 1:171924485-171924507 CAATCATGGTGGAAGGCAAAGGG + Intronic
917245699 1:172997912-172997934 CAATCATGGTGGAAGGCAAAAGG - Intergenic
917516485 1:175712745-175712767 CAATCATGGTGGAAGGCAAAGGG - Intronic
917766204 1:178220083-178220105 CAATCATGGTGGAAGGCAAAGGG - Intronic
918689162 1:187458632-187458654 CAATCATAGCGGAAGGCAAAGGG - Intergenic
918734968 1:188048936-188048958 CAACTTTAGATAAAGGCAGATGG - Intergenic
918998306 1:191792303-191792325 GAATTTTAGTGGAAAGAGGAGGG - Intergenic
919149601 1:193678914-193678936 CAATTGCGGTGGAAGGCAAAGGG - Intergenic
919484966 1:198134510-198134532 CAATCATGGTGGAAGGCAAAAGG - Intergenic
920607577 1:207404342-207404364 CAATCATGGTGGAAGGCAAAGGG - Intergenic
920609012 1:207419280-207419302 CAATTATGGTGAAAGGCAAAGGG - Intergenic
920909918 1:210206709-210206731 CAATCATGGTGGAAGGCAAAGGG - Intergenic
920978967 1:210813963-210813985 CAATCATGGTGGAAGGCAAAAGG - Intronic
921362538 1:214343191-214343213 CAATCATGGTGGAAGGCAAAAGG - Intergenic
921601426 1:217110574-217110596 CAATCATGGTGGAAGGCAAAGGG + Intronic
921933905 1:220778358-220778380 CAATCATGGTGGAAGGCAAAGGG + Intronic
922068624 1:222169038-222169060 CAATCATCGTGGAAGGCAAAGGG - Intergenic
922074337 1:222227961-222227983 CAATCATGGTGGAAGGCAAACGG + Intergenic
922128680 1:222755334-222755356 CAATCATGGTGGAAGGCAAAAGG + Intergenic
922652522 1:227353539-227353561 CAATCATGGTGGAAGGCAAAGGG - Intergenic
923035900 1:230285011-230285033 CACTGGTGGTGGAAGGCAGAGGG + Intergenic
923172213 1:231428534-231428556 CAATCATGGTGGAAGGCAAAGGG + Intergenic
923241803 1:232092665-232092687 GAATTTTAGTGAAAGGTGGAGGG + Intergenic
923250687 1:232177218-232177240 CAATCATGGTGGAAGGCAAAAGG - Intergenic
923334858 1:232959311-232959333 CAATCATGGTGGAAGGCAGAAGG - Intronic
923370841 1:233310800-233310822 CACTCATAGTGGAAGGCAAAGGG + Intergenic
923442769 1:234037205-234037227 CAATTGTGGTGGAAGGTGGAGGG + Intronic
923529762 1:234803908-234803930 CAATCATGGTGGAAGGCAGAGGG - Intergenic
923653685 1:235897304-235897326 CAATCATGGTGGAAGGCAAAGGG - Intergenic
923873674 1:238023638-238023660 CAAACATAGTGGAAGGCAAAGGG + Intergenic
923958853 1:239054468-239054490 AAATTTTAGAGGAAGAGAGAGGG - Intergenic
924372950 1:243373762-243373784 CACTCTCAGTGGAAGGGAGATGG + Intronic
924804354 1:247350460-247350482 CAATCATGGTGGAAGGCAAAAGG - Intergenic
924862575 1:247939884-247939906 CAATTTTAGTGGGAGGGTGGTGG - Intronic
1063006343 10:1974610-1974632 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1063085058 10:2809315-2809337 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1063507477 10:6613939-6613961 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1063719405 10:8564666-8564688 CAATTGTGGTGGAAGGCAAAGGG + Intergenic
1063729120 10:8676039-8676061 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1063878060 10:10500553-10500575 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1064098173 10:12439860-12439882 CAATCATGGTGGAAGGCAAAAGG + Intronic
1064279805 10:13941321-13941343 CAATCATGGTGGAAGGCAGAAGG - Intronic
1064281337 10:13954326-13954348 CAATCATGGTGGAAGGCAAAAGG + Intronic
1064401997 10:15029224-15029246 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1064462642 10:15550195-15550217 CAATCATGGTGAAAGGCAGAAGG - Intronic
1065069842 10:22011890-22011912 CAATTTTAGAAGGAGGTAGAAGG - Intergenic
1065561710 10:26970505-26970527 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1065570651 10:27068327-27068349 CAATCATGGTGGAAGGCAAAAGG - Intronic
1065718077 10:28593346-28593368 GAACTTTAGGGGATGGCAGAGGG + Intronic
1065867423 10:29926168-29926190 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1065908345 10:30279430-30279452 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1066046391 10:31599103-31599125 CAATCATGGTGGAAGGCAAATGG - Intergenic
1066426757 10:35314291-35314313 CAATCATGGTGGAAGGCAAAAGG + Intronic
1066619538 10:37330775-37330797 CAATTATGGTGGAAGGTAAAGGG - Intronic
1067078675 10:43202127-43202149 CAACTTAAGGGGAAGGAAGAAGG - Intronic
1067798597 10:49340012-49340034 CAATTGTGGTGGAAAGCAAAAGG - Intergenic
1067963156 10:50879545-50879567 CAATCATGGTGGAAGGCAAAGGG + Intronic
1068110115 10:52670479-52670501 TAATCATAGTGGAAGGCAAAGGG - Intergenic
1068243430 10:54335644-54335666 CAATCTTGGTGGGAGGCAAAAGG - Intronic
1068337153 10:55648901-55648923 CAATTATGGCGGAAGGCAAAGGG + Intergenic
1068443381 10:57088906-57088928 CAATCACAGTGGAAGGCAAAGGG + Intergenic
1068571393 10:58633205-58633227 CAATCGTGGTGGAAGGCAAATGG - Intronic
1068712257 10:60147748-60147770 CAATCATAGGGGAAGGCAAAGGG - Intronic
1068729308 10:60338510-60338532 CAAATTCAGTAGAATGCAGAAGG + Intronic
1069045673 10:63740915-63740937 CAATTATGGCGGAAGGCAAAGGG + Intergenic
1069055457 10:63839979-63840001 CAATCACAGTGGAAGGCAAAAGG - Intergenic
1069068426 10:63970289-63970311 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1069112360 10:64463733-64463755 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1069168952 10:65201171-65201193 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1069352671 10:67548232-67548254 CAATCATGGTGGAAGGCAAAGGG - Intronic
1070091994 10:73295936-73295958 TAAATTTGGTGGGAGGCAGATGG - Intronic
1070308483 10:75255412-75255434 CAATCATAGTGGAGGGCAAAAGG + Intergenic
1070907397 10:80085135-80085157 CAATTTTTTTGAAGGGCAGAGGG + Intronic
1071119597 10:82262016-82262038 CAATTATGGTGGAAGGCAAAGGG - Intronic
1071204146 10:83254735-83254757 CAATTATGATGGAAGGCAAAGGG + Intergenic
1071306729 10:84305736-84305758 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1071396143 10:85225912-85225934 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1071884936 10:89939514-89939536 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1072265889 10:93727536-93727558 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1072295875 10:94009181-94009203 CAATTATGGTGGAAGGCAAGAGG + Intronic
1072522675 10:96242271-96242293 CAATCATAGTGGAAGGCAAAAGG - Intronic
1072641822 10:97216719-97216741 CAATTATGGTGGAAGGCGAAGGG - Intronic
1072729468 10:97835834-97835856 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1073591708 10:104763929-104763951 CAATCATGGTGGAAGGCAAAAGG - Intronic
1073676658 10:105654993-105655015 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1073701604 10:105934022-105934044 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1073701936 10:105936355-105936377 CAATAATGGTGGAAGGCAAAGGG - Intergenic
1073741912 10:106417026-106417048 CAGTCATGGTGGAAGGCAGAGGG + Intergenic
1073807197 10:107110433-107110455 CAATCATGGTGGAAGGCAAAGGG + Intronic
1073892946 10:108121960-108121982 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1073918645 10:108433848-108433870 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1073952833 10:108830387-108830409 CAATTATGGTGGAAGGTAAAGGG + Intergenic
1074104569 10:110378902-110378924 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1074128629 10:110552822-110552844 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1074266182 10:111905879-111905901 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1074581342 10:114722245-114722267 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1074609583 10:115008774-115008796 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1074728571 10:116342866-116342888 AAATCGTGGTGGAAGGCAGAGGG - Intronic
1074820943 10:117177932-117177954 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1074959807 10:118433026-118433048 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1076155709 10:128203570-128203592 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1076242589 10:128920857-128920879 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1076899657 10:133331786-133331808 CATTTTATATGGAAGGCAGAGGG + Intronic
1076967416 11:101728-101750 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1077399726 11:2348286-2348308 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1077699167 11:4424036-4424058 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1077710327 11:4530505-4530527 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1077984884 11:7341913-7341935 CAATCATGGTGGAAGGCAAAAGG + Intronic
1078393541 11:10957111-10957133 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1078684812 11:13519112-13519134 CAATCATAGTGGAAGGCGAAAGG - Intergenic
1078756853 11:14219259-14219281 CAATTTTATTGAAAAGCAGCAGG + Intronic
1079140829 11:17808351-17808373 CAATCATGGTGGAAGGCAAAGGG + Intronic
1079272825 11:19004702-19004724 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1079648192 11:22893673-22893695 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1079828162 11:25225609-25225631 CAATCATGGTGGAAGGCAGAGGG + Intergenic
1079857903 11:25628984-25629006 CAATTATGGTGGAAGGCAAAAGG - Intergenic
1079952547 11:26822990-26823012 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1080057673 11:27924466-27924488 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1080109138 11:28546063-28546085 CAATCATGGTAGAAGGCAGAGGG + Intergenic
1080228023 11:29983051-29983073 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1080262923 11:30369392-30369414 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1080424810 11:32145840-32145862 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1080449879 11:32369932-32369954 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1080611233 11:33905859-33905881 CAATCATAGTGGAAGGCGAAGGG - Intergenic
1080822170 11:35817885-35817907 CAATCATGGTGGAAGGCAAAGGG - Exonic
1080903042 11:36513700-36513722 CAATCATGGTGGAAGGCAAAAGG + Intronic
1080970932 11:37275957-37275979 CAATCATAGTGGAAGACAAAGGG - Intergenic
1080990414 11:37528433-37528455 CAATCATAGTGGAAGGGTGAAGG + Intergenic
1081016923 11:37893209-37893231 CAATCTTGGTGGAAGACAAAGGG + Intergenic
1081024813 11:37998211-37998233 CAATCATAATGGAAGGCAAAGGG + Intergenic
1081441333 11:43084901-43084923 CAATCATAGTGGAAGGCAAGGGG + Intergenic
1081961106 11:47138165-47138187 CAATCGTGGTGGAAGGCAAAGGG + Intronic
1082101963 11:48180078-48180100 CAAGTTTAGTGGAAGGATAAAGG - Intergenic
1082555864 11:54562386-54562408 TAATTTTAGTATAAGGCATAAGG + Intergenic
1082565952 11:54677658-54677680 CAATTATAGCCGAAGGCAAAGGG - Intergenic
1082692800 11:56326136-56326158 CAATTATGGTGGAAGACAAAAGG - Intergenic
1085060285 11:73439650-73439672 AAATTTTAATGGGAAGCAGATGG + Intronic
1085092060 11:73725518-73725540 CAATCATAGTGGAAGGCGAAAGG + Intronic
1085476532 11:76792720-76792742 CAATCATGGTGGAAGGCAAAAGG - Exonic
1085599502 11:77842493-77842515 CAATTTCAGGGGAAGTCATAAGG - Exonic
1085745506 11:79111190-79111212 CAATTATGGTGGAAGGCGAAAGG - Intronic
1086286639 11:85259308-85259330 CAATCATGGTGGAAGGCAAAGGG - Intronic
1086333386 11:85776160-85776182 CACTCCTAGAGGAAGGCAGAAGG - Intronic
1086363331 11:86081880-86081902 TAATTTTTGTGAAAGGCATAAGG + Intergenic
1086592951 11:88537537-88537559 AAATTCTAGATGAAGGCAGAAGG + Intronic
1086669172 11:89526711-89526733 CAATCATGGTGGAAGGCAAATGG - Intergenic
1087024582 11:93637005-93637027 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1087219726 11:95533276-95533298 CAGTTTTAGTGGAGGCCACATGG + Intergenic
1087511455 11:99101059-99101081 CAATGATAGTGGAAGGCGAAAGG + Intronic
1087537310 11:99465786-99465808 AAATTGTGGTGGAAGGCAAAGGG + Intronic
1087668841 11:101082176-101082198 CAATCATGGTGGAAGGCAAATGG - Intronic
1087708275 11:101520292-101520314 CAATTGTGGTGGAAGGCGAAGGG - Intronic
1088022089 11:105131675-105131697 CAATCATATTGGAAGGCAAATGG + Intergenic
1088123159 11:106393613-106393635 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1088192493 11:107241193-107241215 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1088352017 11:108900183-108900205 CAATCGCAGTGGAAGGCAAAGGG - Intronic
1088545506 11:110954923-110954945 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1088869326 11:113877824-113877846 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1088910829 11:114190959-114190981 CAATCATGGTGGAAGGCAAAGGG + Intronic
1089086372 11:115820882-115820904 CAATAATAATGGAAGTCAGAAGG + Intergenic
1089553734 11:119302693-119302715 CTACTTTAGTGGAAGGAACATGG - Exonic
1089827276 11:121289891-121289913 CAATCCTGGTGGAAGGCAAAGGG - Intergenic
1090022601 11:123141032-123141054 CAATCATGGTGGAAGGCAAAGGG - Intronic
1090113093 11:123937668-123937690 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1090431212 11:126648164-126648186 CAATCATGGTGGAAGGCAAAGGG - Intronic
1090595475 11:128316091-128316113 CAATCATGGTGGAAGGCTGAAGG + Intergenic
1091249292 11:134128696-134128718 CAATCATGGTGGAAGGCATAGGG - Intronic
1091701848 12:2668604-2668626 CAATCATGGTGGAAGGCAAAGGG + Intronic
1092336365 12:7637794-7637816 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1092656163 12:10687430-10687452 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1092735294 12:11576752-11576774 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1093372022 12:18376850-18376872 CAATCATGGTGGAAGGCAAAGGG - Intronic
1093426173 12:19031849-19031871 CAATCTTGGGGGAAGGCAAAGGG + Intergenic
1093426488 12:19034211-19034233 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1093485335 12:19646267-19646289 CAATCTTGGTGGAAGGCGAAGGG + Intronic
1093513784 12:19960808-19960830 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1093753845 12:22830740-22830762 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1093989067 12:25569781-25569803 CAATCATGGTGGAAGGCAAAGGG - Intronic
1094432830 12:30388750-30388772 CAATTATGATGGAAGGCAAAGGG + Intergenic
1094794325 12:33953069-33953091 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1095106177 12:38235678-38235700 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1095158314 12:38885919-38885941 CAATCATGGTGGAAGGCACAAGG - Intronic
1095216524 12:39556520-39556542 CAATCATGGTGGAAGGCAAACGG - Intronic
1095389786 12:41692202-41692224 CAGTTGTGGTGGAAGGCAAAGGG - Intergenic
1095641821 12:44494621-44494643 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
1095859303 12:46897914-46897936 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1096088761 12:48884083-48884105 GAATGTTTATGGAAGGCAGAGGG + Intergenic
1096902503 12:54899961-54899983 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1097513230 12:60568983-60569005 CAATCTTGGTGGAAGGCAAAGGG - Intergenic
1097571124 12:61334198-61334220 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1097647165 12:62250089-62250111 CACTCATGGTGGAAGGCAGAAGG + Intronic
1098435251 12:70461563-70461585 CAATCATGGTGGAAGGCAGAGGG - Intergenic
1098631052 12:72721715-72721737 CAATCGTGGTGGAAGGCAAAAGG - Intergenic
1098767786 12:74511429-74511451 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1098800853 12:74955919-74955941 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1098882132 12:75927434-75927456 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1098992026 12:77074126-77074148 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1099254909 12:80303643-80303665 CAATCATTGTGGAAGGCAAAGGG + Intronic
1099386227 12:82017072-82017094 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1099386576 12:82019764-82019786 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1099796907 12:87410927-87410949 CAATCATAGTAGAAGGCAAAAGG - Intergenic
1099893684 12:88619165-88619187 CCATTTCAGTGGAATGCTGAGGG + Intergenic
1099960735 12:89394732-89394754 AAATTTTAGAGGGAGGCAGGGGG - Intergenic
1100040140 12:90306645-90306667 CAATTTTATTGAAAATCAGATGG + Intergenic
1100278046 12:93090046-93090068 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1100497700 12:95141328-95141350 CAATTTTAGATGAAGCCATAAGG - Intronic
1100567197 12:95808131-95808153 CAATCATGGTGGAAGGCAAACGG + Intronic
1100900589 12:99236395-99236417 CAATCATGGTGGAAGGCAAAGGG + Intronic
1101207959 12:102507668-102507690 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1101690640 12:107076925-107076947 CAATCATGGTGGAAGGCAAAGGG - Intronic
1101696581 12:107132847-107132869 CAATTATGGTGGAAGGCAAAAGG - Intergenic
1102448433 12:113022199-113022221 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1102503210 12:113367115-113367137 CAATGTTAGTGACAAGCAGAGGG + Intronic
1102615637 12:114151795-114151817 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1102708894 12:114908034-114908056 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1102716550 12:114978406-114978428 CAATCATGGTAGAAGGCAGAAGG + Intergenic
1102778968 12:115546937-115546959 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1102892440 12:116570664-116570686 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1103276385 12:119715162-119715184 CAATCATGGTGGAAGGCAAAAGG - Intronic
1103954828 12:124570078-124570100 CCATTTTACAGGAAGGGAGAGGG + Intergenic
1104114513 12:125736421-125736443 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1104404546 12:128506641-128506663 CATTTTCAGAGGAAGGGAGACGG - Intronic
1104487300 12:129162719-129162741 CAAACATGGTGGAAGGCAGAGGG - Intronic
1105533146 13:21237957-21237979 CAATCATGGTGGAAGGCAGAGGG - Intergenic
1105856923 13:24382614-24382636 CAAATCTACTGGAAGACAGAGGG - Intergenic
1106662259 13:31811632-31811654 CACTCCTAGTGGAAGGCAAAGGG - Intergenic
1106788716 13:33132450-33132472 CAATCATGGTGGAAGGCAAAAGG - Intronic
1106861197 13:33910844-33910866 CAATCATGGTGGAAGGCAAAGGG + Intronic
1107088282 13:36448823-36448845 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1107231827 13:38119165-38119187 CAATTTTGGCAGAAGGCAAAGGG + Intergenic
1107323947 13:39220111-39220133 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1107354832 13:39556043-39556065 TAATCTTGGTGGAAGGCAAAGGG - Intronic
1107432730 13:40354618-40354640 CAAATATGGTGGAAGGCAAAGGG + Intergenic
1107511889 13:41093525-41093547 CAATCATTGTGGAAGGCAAAAGG - Intergenic
1107533637 13:41307693-41307715 CAATCATGGTGGAAGGCAAACGG - Intergenic
1107635356 13:42386798-42386820 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1107949975 13:45452990-45453012 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1108141857 13:47431861-47431883 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1108512122 13:51165726-51165748 CAATTTTGGTGGGATGCTGATGG + Intergenic
1108715912 13:53077681-53077703 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1108882441 13:55137149-55137171 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1108929972 13:55806407-55806429 CAATTATGGTGGAAGGCGAAAGG + Intergenic
1108990374 13:56648676-56648698 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1109153078 13:58869123-58869145 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1109391110 13:61694902-61694924 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1109642581 13:65209758-65209780 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1109845867 13:67990005-67990027 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1109910862 13:68908230-68908252 CAATCTTGGCGGAAGGCAAAGGG - Intergenic
1109992881 13:70082112-70082134 CAATTATGGAGGAAGGCAAAGGG - Intronic
1110044905 13:70814918-70814940 CAATTGTGGTGGAAGGTAAAGGG - Intergenic
1110079812 13:71295912-71295934 CAATCATAGTGGAAAGCAAAGGG + Intergenic
1110379907 13:74838874-74838896 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1110423147 13:75335749-75335771 CAATCATGGTGGAAGGCAAAGGG - Intronic
1110440427 13:75520170-75520192 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1110495390 13:76161992-76162014 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1110543635 13:76733023-76733045 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1110625806 13:77654306-77654328 CAATTATGGAGGAAGGCAAAGGG + Intergenic
1110632136 13:77721269-77721291 CAATCATAGTGGAAGGTAAAGGG - Intronic
1110842732 13:80161374-80161396 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1110893052 13:80713950-80713972 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1110893516 13:80719813-80719835 CAATCATGGTGGAAGGCAAATGG + Intergenic
1110986425 13:81975731-81975753 TAATTTTTGTGGTAGGAAGAGGG + Intergenic
1111015420 13:82373748-82373770 CAATCATAGTGGAAGGCGAAAGG - Intergenic
1111132380 13:83994117-83994139 TAATTTTTGTGAAAGGCATATGG - Intergenic
1111179985 13:84651622-84651644 CAATCGTGGTGAAAGGCAGATGG - Intergenic
1111233282 13:85372812-85372834 CAATTATGGCAGAAGGCAGAGGG - Intergenic
1111241465 13:85481046-85481068 CAATAGTGGTGGAAGGCAAAGGG + Intergenic
1111310665 13:86480204-86480226 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1111323822 13:86664989-86665011 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1111442280 13:88295237-88295259 CAATCATCGTGGAAGGCAAAAGG - Intergenic
1111468982 13:88651713-88651735 CAGTTGTGGTGGAAGGCAAAGGG + Intergenic
1111587995 13:90307347-90307369 CAATCATAGCGGAAGGCAAACGG - Intergenic
1111742836 13:92226143-92226165 CAATCATGGTGGAAGGCAAAGGG - Intronic
1111815976 13:93152838-93152860 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1111816757 13:93163483-93163505 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1111887605 13:94042209-94042231 CAATCATGGTGGAAGGCAAAGGG - Intronic
1112052922 13:95662148-95662170 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1112095874 13:96131109-96131131 CAGTTTTAATGGAAAGCTGAGGG - Intronic
1112190415 13:97171946-97171968 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1112223404 13:97514118-97514140 CAATTATAATGGAAGGCAAACGG + Intergenic
1112238417 13:97657278-97657300 CAATAATGGTGGAAGGCAAAGGG - Intergenic
1112265459 13:97919568-97919590 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1112405906 13:99120011-99120033 CAATCATGGCGGAAGGCAGAAGG - Intergenic
1112626178 13:101106739-101106761 CAATCATGGTGGAAGGCAAAAGG - Intronic
1112894199 13:104278259-104278281 CAATCATGGTGGAAGGCTGAGGG + Intergenic
1112924686 13:104659625-104659647 CAATCATAGTGGAAGGCTAAGGG - Intergenic
1113048827 13:106186003-106186025 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1113049105 13:106188709-106188731 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1113197377 13:107824176-107824198 ACAATTTAGTGGAAAGCAGATGG - Intronic
1113213629 13:108012266-108012288 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1113320777 13:109230044-109230066 CAATTGTCGTGGAAGGCGAAGGG + Intergenic
1113368001 13:109695799-109695821 CAATTTTACTGAATGGCTGAAGG + Intergenic
1113436125 13:110292580-110292602 CAATCATGGTGGAAGGCAAAGGG + Intronic
1113501674 13:110780895-110780917 CAATCATAGTGGAAGGCAAAGGG + Intergenic
1113547995 13:111169384-111169406 CAATCGTGGTGGAAGGCAAAGGG + Intronic
1113693523 13:112328658-112328680 CAATGACAGTGGAAGGCAAAGGG + Intergenic
1114244636 14:20901285-20901307 CAATCATGGTGGAAGGCACAGGG + Intergenic
1114247633 14:20929428-20929450 CAATCATGGTGGAAGGCACAGGG + Intergenic
1114248725 14:20938505-20938527 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1114547348 14:23512607-23512629 CAATATTTATGGCAGGCAGAGGG - Intergenic
1114771664 14:25434000-25434022 TAATTTTTGTGTAAGGCGGAAGG - Intergenic
1114850159 14:26373854-26373876 CAATCATGGTGGAAGGCAAATGG - Intergenic
1115219106 14:31041630-31041652 TAATTTTAGAGAAAGGCAGTGGG - Intronic
1115382892 14:32759675-32759697 CAATCATAGTGGAAGGCAAAGGG + Intronic
1115384169 14:32776413-32776435 CAATCATGGTGGAAGGCAAAAGG - Intronic
1115609326 14:35036343-35036365 CAATTATGGTGGAAGGCAAAAGG + Intergenic
1115936457 14:38558638-38558660 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1115944566 14:38644768-38644790 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1115953126 14:38744335-38744357 CAATCATAGTGGAAGGCGAAGGG + Intergenic
1116072578 14:40067691-40067713 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1116696543 14:48184328-48184350 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1116789599 14:49326537-49326559 CAATTACGGTGGAAGGCAAAGGG - Intergenic
1116815147 14:49576855-49576877 CAATTATGGTAGAAGGCAAAAGG - Exonic
1116895418 14:50311326-50311348 GAAGTTTAGTGGAAGACATATGG - Intronic
1116906240 14:50406432-50406454 CAATCATGGTGGAAGGCAAAGGG - Intronic
1117039605 14:51757664-51757686 CAATTTTAGAGTAAGACAAAAGG - Intergenic
1117318816 14:54601005-54601027 CAATTTCAGCTGAAGCCAGATGG - Intronic
1117510772 14:56448714-56448736 CACTTGTAGTGGAAGACAAAGGG - Intergenic
1117834953 14:59794320-59794342 AACTTATAGAGGAAGGCAGATGG + Intronic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1118113960 14:62752839-62752861 CAATCATGGTGGAAGGCAAAGGG - Intronic
1118126790 14:62914162-62914184 CTATTTTTGTGGAAGGCATATGG - Intronic
1118172043 14:63396794-63396816 CATTTTTTGAGGAAGGAAGAAGG - Intronic
1118233248 14:63974328-63974350 CATTCATAGTGGAAGGCAAAGGG + Intronic
1118301611 14:64621757-64621779 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1118619590 14:67602184-67602206 CAATAATGGTGGAAGGCAAAGGG + Intergenic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1118851031 14:69583693-69583715 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1118889821 14:69899481-69899503 CAATCATAGCGGAAGGCATAAGG - Intronic
1119082212 14:71705855-71705877 CAATTTTACTGTAAGTGAGAAGG - Intronic
1119142838 14:72283576-72283598 CAATCATGGTGGAAGGCAAAAGG - Intronic
1120038010 14:79720142-79720164 CAATCATGGTGGAAGGCAAAGGG + Intronic
1120099814 14:80431774-80431796 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1120139314 14:80910527-80910549 CAATCATGGTGGAAGGCAAAGGG - Intronic
1120223048 14:81757389-81757411 CAATCATAGCGGAAGGCAAAGGG - Intergenic
1120290967 14:82570081-82570103 CATTTATGGTGGAAGGCAAAAGG - Intergenic
1120315796 14:82890982-82891004 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1120434413 14:84462750-84462772 AACATTTAGTGGATGGCAGATGG - Intergenic
1120475785 14:84985083-84985105 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1120477634 14:85008459-85008481 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1120519692 14:85512135-85512157 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1120614140 14:86681288-86681310 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1120796080 14:88634247-88634269 CAATCATGGTGGAAGGCAAAGGG - Intronic
1120875282 14:89369611-89369633 CAATCATGGTGGAAGGCAAAAGG + Intronic
1120934694 14:89883047-89883069 CACTCTTGGTGGAAGGCAAAGGG - Intronic
1120972861 14:90223008-90223030 CAATCATGGTGGAAGGGAGAAGG + Intergenic
1121033633 14:90680721-90680743 GCATTTTAGTGGTAGGCAGAAGG + Intronic
1121961252 14:98262327-98262349 CAATCATGGTGGAAGGTAGAGGG + Intergenic
1122064933 14:99166260-99166282 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1122085185 14:99295780-99295802 CAATCGTGGTGGAAGGCAAAAGG - Intergenic
1122377933 14:101279076-101279098 CAATCATGGTGGAAGGCAAATGG + Intergenic
1122553827 14:102565589-102565611 CAGTCATAGTGGAAGGCAAAGGG - Intergenic
1122845684 14:104496859-104496881 CAAATCTACTGGAAGACAGAAGG - Intronic
1123213515 14:106784435-106784457 CAGTTATGGTGGAAGGCAAAGGG + Intergenic
1123214267 14:106791907-106791929 CAATGATAGTGAAAGGCAAAAGG - Intergenic
1202946974 14_KI270726v1_random:37063-37085 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1123808896 15:23903664-23903686 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1123826866 15:24091441-24091463 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1123841472 15:24252305-24252327 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1123848939 15:24334124-24334146 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1123867998 15:24541633-24541655 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1124047498 15:26163821-26163843 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1124463134 15:29911520-29911542 CAATCATGGTGGAAGGCAAAGGG + Intronic
1124478057 15:30053043-30053065 CAATCATAGTGGAAGGCAAAGGG + Intergenic
1124862863 15:33459752-33459774 CAAATTTAGAGCAAGGCAGCTGG - Intronic
1124885155 15:33678418-33678440 CAATTGTGGTGGAAGGCAGAGGG - Intronic
1125286126 15:38094321-38094343 CAGTTTTAGTGGATGGCTGAAGG - Intergenic
1125626334 15:41112218-41112240 ATATTTTTGGGGAAGGCAGAAGG + Intronic
1125785315 15:42311594-42311616 CAATTATGATGGAAGGCAAAGGG + Intronic
1125981462 15:44005614-44005636 CAATCATGGTGGAAGGCAAAGGG + Intronic
1126146219 15:45475228-45475250 CATGTTCAGTGGCAGGCAGATGG + Intergenic
1126463278 15:48936571-48936593 CAATCATGGTGGAAGGCAAAGGG - Intronic
1126519431 15:49574522-49574544 CAATCATGGTGGAAGGCAAAAGG - Intronic
1126929388 15:53631285-53631307 CAATTATGGTAGAAGGCAAAGGG - Intronic
1127015569 15:54682888-54682910 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1127690256 15:61388605-61388627 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1127721788 15:61709118-61709140 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1128458416 15:67846834-67846856 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1128619430 15:69136416-69136438 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1128803794 15:70515423-70515445 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1128863026 15:71090717-71090739 CAATCATGGTGGAAGGCACAGGG + Intergenic
1129359524 15:75015993-75016015 CCATTTAAGTGCAAGGTAGATGG + Intronic
1129547354 15:76410587-76410609 CAATTAGAGTGGAAGCAAGAAGG - Intronic
1129900593 15:79145264-79145286 CAATTATGGTGGAAGGCAAAAGG + Intergenic
1130009438 15:80137858-80137880 TAATTTTAGTTGAGTGCAGAGGG + Exonic
1130015814 15:80185613-80185635 CAATCATAGTGGAAGGCAAAAGG + Intronic
1130059295 15:80558132-80558154 CAATATGAGTGGAAAGCTGAAGG - Intronic
1130163575 15:81427488-81427510 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1130734711 15:86536213-86536235 AAATTTTAGTGAAAAGCAAAGGG + Intronic
1130838787 15:87677952-87677974 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1130943705 15:88534301-88534323 CATTTTTAGTGGGAGAGAGAAGG - Intronic
1131463981 15:92639805-92639827 CAATCATGGTGGAAGGCAAAGGG - Intronic
1131622048 15:94078622-94078644 CAATTATAGCAGAAGGCAAAGGG - Intergenic
1131678127 15:94692442-94692464 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1131726681 15:95234356-95234378 CAACCATGGTGGAAGGCAGAGGG + Intergenic
1131848656 15:96514708-96514730 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1132014473 15:98303556-98303578 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1132407904 15:101555568-101555590 CCCTTTTAGTTGAAGGCTGAGGG + Intergenic
1132440755 15:101862099-101862121 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1132810982 16:1797028-1797050 CAATCATGGCGGAAGGCAGAGGG - Intronic
1133041608 16:3063939-3063961 GAATTGTAGTGGGAGACAGAAGG - Intergenic
1133045319 16:3085117-3085139 CAATCTTGGTGAAAGGCAAAGGG + Intergenic
1133077814 16:3293317-3293339 CAATTATGGCGGAAGGCAAAGGG - Intronic
1133343522 16:5054860-5054882 CAATCATAGTGGAAGGCGAAAGG - Intronic
1133657063 16:7875740-7875762 CAGTTATGGTGGAAGGCAAAGGG + Intergenic
1133753538 16:8744287-8744309 CAATCATGGTGGAAGGCAAAGGG + Intronic
1133865298 16:9636658-9636680 CAATCATAGTGGAAGGCAAAGGG + Intergenic
1133866852 16:9652130-9652152 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1134243438 16:12522678-12522700 CAATCATGGTGGAAGGCAAAGGG - Intronic
1134296837 16:12953813-12953835 CAATCGTGGTGGAAGGCAAAGGG + Intronic
1134338482 16:13323645-13323667 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1134773876 16:16834972-16834994 AAAGTCTAGTGGAAGACAGATGG - Intergenic
1134789935 16:16980673-16980695 TAATTTTGGTGGAAAGGAGACGG + Intergenic
1134816895 16:17213242-17213264 CAATTGTGGTGGAAGGTAAAGGG - Intronic
1134829492 16:17311794-17311816 CAATCATGGTGGAAGGCAAAAGG + Intronic
1135654867 16:24239129-24239151 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1135913430 16:26581712-26581734 CAATCATAGTAGAAGGCAAAGGG + Intergenic
1135964867 16:27027527-27027549 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1136104657 16:28021218-28021240 CAATCATGGTGGAAGGCAGAAGG + Intronic
1137006592 16:35281316-35281338 CAATTATGGTGGAAGGGAAAGGG + Intergenic
1137293975 16:47072450-47072472 AATTTTTAAAGGAAGGCAGAAGG + Intergenic
1137923819 16:52520227-52520249 CAATTTTATTGGAAAACTGAAGG - Intronic
1138107387 16:54295856-54295878 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1138168369 16:54824693-54824715 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1138207099 16:55133150-55133172 CCATTTAGGTGGAGGGCAGAGGG + Intergenic
1138225757 16:55292875-55292897 CAATTTTGATGGCAAGCAGAGGG + Intergenic
1138293396 16:55867187-55867209 CAGGTTTAGTGGAAGGGAGCTGG - Intronic
1138771125 16:59665166-59665188 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1138778181 16:59750667-59750689 CAATCATGGTGGAAGGCAAAGGG + Intronic
1139196833 16:64929553-64929575 CAATCATAGTGGAAGACAAAGGG + Intergenic
1139290284 16:65852121-65852143 CAATCATAGCGGAAGGCAAAGGG + Intergenic
1139963776 16:70733680-70733702 CAATCATAGTGGAAGGCAAAGGG - Intronic
1140131551 16:72166357-72166379 CAATCATAGCGGAAGGCAAAGGG - Intronic
1140418108 16:74792020-74792042 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1140638931 16:76949160-76949182 CAATTATGGTGGAAGGCAAAAGG + Intergenic
1140705700 16:77627180-77627202 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1140775831 16:78248225-78248247 CAATCATGGTGGAAGGCAAAGGG + Intronic
1141344516 16:83232631-83232653 CAATCATGGTGGAAGGCAAAGGG - Intronic
1141403713 16:83773408-83773430 CAATCATGGTGGAAGGCAAATGG + Intronic
1141421561 16:83921126-83921148 GAGTTTTAATGGAAGGAAGATGG + Exonic
1142909741 17:3079035-3079057 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1142924761 17:3224783-3224805 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1144062000 17:11591382-11591404 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1144227435 17:13163345-13163367 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1144325155 17:14172104-14172126 CCAGTTGAGTGGAAGACAGATGG - Intronic
1144474031 17:15568983-15569005 CCAGTTGAGTGGAAGACAGATGG - Intronic
1144605307 17:16659428-16659450 CAATCATGGTGGAAGGCAAACGG + Intergenic
1145069649 17:19793103-19793125 CGATTACAGTGGAAGGCAAAGGG + Intronic
1145191978 17:20850796-20850818 CAATTTTCGTGGCAAGCATATGG - Intronic
1145817804 17:27808048-27808070 CAATTTGAGTGGGAGGCTGTGGG + Intronic
1146090723 17:29874613-29874635 CAATCATGGTGGAAGGCAAAGGG - Intronic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146364570 17:32211349-32211371 GAATTTTAGTGGAAGTTAGTTGG - Intronic
1146391927 17:32430673-32430695 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1146541228 17:33697121-33697143 CAATAATGGTGGAAGGCAAAGGG - Intronic
1146922863 17:36725099-36725121 CAATTTTAGGGGAACGGGGAGGG + Intergenic
1148428822 17:47625160-47625182 AAATTTTAGTGGAAATCAGAAGG + Intergenic
1148628431 17:49088272-49088294 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1148762452 17:50013846-50013868 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1149154773 17:53614633-53614655 CTGTTTTAGTGGGAGGCAGCAGG - Intergenic
1149189410 17:54041202-54041224 TAATTATGGTGGAAGGCAAAGGG + Intergenic
1149201355 17:54189594-54189616 TAATTATGGTGGAAGGCAAAGGG + Intergenic
1149292725 17:55233139-55233161 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1149294616 17:55250531-55250553 CAATTATGGTGAAAGGCAAAGGG - Intergenic
1149335214 17:55628230-55628252 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1149380443 17:56088289-56088311 CAATTTTAGAGGAATGAGGAGGG + Intergenic
1149718589 17:58819655-58819677 CAATCATGGTGGAAGGCAAAGGG + Intronic
1150017811 17:61576565-61576587 CAATTTTATTGCAAAGCAAAAGG + Intergenic
1150178834 17:63092622-63092644 CAATCATAGTGGAAGGTGGATGG + Intronic
1150615615 17:66768591-66768613 CAATCATGGCGGAAGGCAGAGGG + Intronic
1150933518 17:69610950-69610972 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1150950085 17:69793456-69793478 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1150991905 17:70269310-70269332 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1151018132 17:70580689-70580711 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1151061596 17:71100918-71100940 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1151915127 17:77112182-77112204 CAATCATGGTGGAAGGCAAAGGG - Intronic
1152372599 17:79899139-79899161 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1152937230 17:83146452-83146474 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1153150559 18:2087853-2087875 CAATCTTGGTGGAAGGCAAAAGG - Intergenic
1153336290 18:3929048-3929070 CAATGATAGTAGAAGGCGGAGGG - Intronic
1153389527 18:4538590-4538612 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1153534430 18:6085665-6085687 CAATCATGGTGGAAGGCAAAGGG - Intronic
1153724827 18:7943773-7943795 CTATTTATGAGGAAGGCAGAAGG - Intronic
1153845949 18:9050047-9050069 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1154183265 18:12156147-12156169 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1154366701 18:13716784-13716806 CAATCATAGTGGAAGGCAAAGGG - Intronic
1155125661 18:22873008-22873030 CAATCATGGTGGAAGGCAAAGGG + Intronic
1155449673 18:25950597-25950619 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1155634623 18:27938161-27938183 CAATCTTGGTGGAAGGCGAAGGG - Intergenic
1155767030 18:29648886-29648908 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1155901209 18:31393444-31393466 CAATCATTGTGGAAGGCAAAGGG + Intronic
1156068387 18:33174110-33174132 CAATCATGGTGGAAGGCAAAGGG + Intronic
1156074666 18:33259482-33259504 CAATCATAGCGGAAGGCAAAGGG + Intronic
1156115582 18:33783644-33783666 CAATTTTTGTGGGTGGCAGCAGG + Intergenic
1156195314 18:34768167-34768189 GAATTGGAGGGGAAGGCAGAGGG + Intronic
1156343506 18:36234801-36234823 CAATTATGGTGGAAGGCAAAGGG + Intronic
1156599403 18:38587025-38587047 CAAATTAAGTGGAAAACAGAGGG - Intergenic
1156721127 18:40071131-40071153 CAATCATAGAGGAAGGCAAAGGG - Intergenic
1156904601 18:42337956-42337978 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1156960390 18:43021704-43021726 CAATCATGGTGGAAGGCAAAGGG - Intronic
1157152498 18:45232232-45232254 CAATTATGGTGGAAGGTAAAGGG + Intronic
1157156131 18:45268097-45268119 CAATTTTTTTGCAAGGGAGAGGG - Intronic
1157531783 18:48427396-48427418 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1157877453 18:51287095-51287117 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1157913066 18:51637552-51637574 GAATATTTATGGAAGGCAGAAGG - Intergenic
1158194446 18:54868332-54868354 CAATCATAGTGGAAGGCAAAAGG - Intronic
1158559089 18:58498795-58498817 CAATCATGGTGGAAGGCGGAAGG - Intronic
1158677776 18:59537534-59537556 CAATCATGGTGGAAGGCAAAAGG - Intronic
1158751832 18:60271045-60271067 CAATCATGGTGGAAGGCAGCAGG + Intergenic
1159002925 18:62989103-62989125 CAATTATGTTGGAAGGCAAAGGG - Intergenic
1159070014 18:63612915-63612937 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1159088969 18:63824968-63824990 CAATTATGGTGGGAGGCAAAGGG + Intergenic
1159265701 18:66075302-66075324 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1159313892 18:66745668-66745690 CAAATGGAGTGGAAGACAGATGG + Intergenic
1159476560 18:68928300-68928322 CAATCTTATGGGAAGGCAAAAGG + Intronic
1159481670 18:68997109-68997131 CAATCACAGTGGAAGGCAAAGGG - Intronic
1160353815 18:78209241-78209263 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1160372025 18:78381458-78381480 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1160644220 19:171351-171373 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1162602622 19:11680532-11680554 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1163070547 19:14837079-14837101 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1164091814 19:21960739-21960761 CAATCATGGTGGAAGGCAAAGGG - Intronic
1164111564 19:22165041-22165063 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1164406887 19:27957194-27957216 CAATCATAATGGAAGGCAAAGGG + Intergenic
1164486562 19:28661047-28661069 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1164657924 19:29938270-29938292 CAATCATGGTGGAAGGCAAATGG + Intronic
1165288993 19:34868007-34868029 CAATCATGGTGGAAGGCAGAAGG + Intergenic
1165792018 19:38498337-38498359 CAGATTGAGGGGAAGGCAGAAGG + Intronic
1166017384 19:39992934-39992956 CAGTCATAGTGGAAGGCAGAGGG - Intronic
1166828756 19:45625773-45625795 CAAGTTGAGTGGGAAGCAGAGGG - Intronic
1166969770 19:46558464-46558486 CAATTATGGTGGAAGGCGAAAGG + Intronic
1166978652 19:46620089-46620111 GAATTTCAGTGGAAGGTTGAGGG + Intergenic
1167136059 19:47616334-47616356 CATTTTAAATGGAAGGCACAGGG + Intronic
1168363539 19:55764291-55764313 CAATCATGGAGGAAGGCAGAGGG + Intergenic
1168364495 19:55774295-55774317 CAATCATGGAGGAAGGCAGAGGG + Intergenic
1168485505 19:56758954-56758976 CAATGGGAGTGGAAGGCTGAGGG + Intergenic
924979132 2:204367-204389 CAATCATGGTGGAAGGCAAAGGG - Intergenic
925096887 2:1212317-1212339 CAATCATGGTGGAAGGCAGAAGG - Intronic
925116269 2:1380885-1380907 CAATCCTGGGGGAAGGCAGAGGG + Intronic
925117545 2:1393157-1393179 CAATTGTAGCGGAAGGCAGAGGG + Intronic
925900826 2:8508455-8508477 CAATCATGGTGGAAGGCAAAGGG - Intergenic
925983650 2:9197523-9197545 CAATCATGGTGGAAGGCAAAAGG + Intergenic
926431168 2:12786948-12786970 CAATCGTGGTGGAAGGCAAAAGG + Intergenic
926535672 2:14108224-14108246 CAATCATGGTGGAAGGCAAAGGG - Intergenic
926545853 2:14238848-14238870 CAATTATGGTGGAAGGCAAAGGG - Intergenic
926607680 2:14914010-14914032 CAATCATGGTGGAAGGCAAAAGG + Intergenic
926629494 2:15123689-15123711 CAATTATAGTAGAAGGCAACAGG - Intergenic
926638396 2:15208183-15208205 CAATCATAGTGGAAGGCAAAAGG + Intronic
927124398 2:20000114-20000136 AAACTTTAGTGGAAGTCAGTTGG - Intronic
927471495 2:23380938-23380960 CAGTTTCTGTGGGAGGCAGAGGG - Intergenic
927831824 2:26358028-26358050 CAATCATAGTGGAAGGCGAAAGG - Intronic
927987195 2:27420333-27420355 CCATGTAAGAGGAAGGCAGAGGG - Intergenic
928332954 2:30371545-30371567 CAATCACAGTGGAAGGCAAAAGG - Intergenic
928464853 2:31514197-31514219 CAATTATAGTGGAAGGTGAAAGG + Intergenic
928488668 2:31758307-31758329 CAATCATGGTGGAAGGCAAAGGG - Intergenic
928626637 2:33146676-33146698 CAATCATGGTGGAAGGCAAAGGG + Intronic
928813254 2:35254947-35254969 CAATCATGGTGGAAGGCAAAGGG + Intergenic
928893934 2:36239679-36239701 CAATCATAGTGGAAAGCAAAAGG + Intergenic
929117445 2:38456354-38456376 CAATCCTGGTGGAAGGCAAAGGG + Intergenic
929133419 2:38601601-38601623 AAATGTTAGGGGGAGGCAGAAGG - Intronic
929172985 2:38949817-38949839 CAATTATGGTGGAAGGCGAAGGG + Intronic
929188912 2:39121792-39121814 CAATGTTAGTGGAATGCTAAAGG + Intronic
929239479 2:39639320-39639342 CAATTTTAGTGTCAGGAAGGAGG - Intergenic
929393187 2:41494923-41494945 CTATTTTAATTGGAGGCAGAAGG - Intergenic
929668081 2:43849323-43849345 CAATCATGGTGGAAGGCAAAGGG + Intronic
929759085 2:44791220-44791242 CAATCATGGTGGAAGGCAAAAGG + Intergenic
929763334 2:44824261-44824283 CAGTTTTAGAGGGAGACAGATGG + Intergenic
930272864 2:49277181-49277203 CAATTTTAGTGGGTGTCATAAGG - Intergenic
930516342 2:52412169-52412191 CAATTATGGTGGAAGGCCAAGGG - Intergenic
930644747 2:53893561-53893583 CCATTTTAGATCAAGGCAGATGG + Intronic
930934336 2:56929282-56929304 CAATCATGGTGGAAGGCAAAGGG - Intergenic
931265728 2:60658440-60658462 CAATCATAGTGGAAGGCAAAAGG - Intergenic
931552414 2:63461410-63461432 CAATCATGGTGGAAGGCAAAGGG - Intronic
931590222 2:63874850-63874872 CACTCATAGTGGAAGGCAGAGGG - Intronic
931622655 2:64226800-64226822 CAATCCTAGTGGAAGGCAAAGGG - Intergenic
931636083 2:64341739-64341761 GAACTTTACTGGAAGGCAGTTGG - Intergenic
932061014 2:68497492-68497514 CAATCATGGTGGAAGGCAAAGGG - Intronic
932111192 2:69002573-69002595 CAATCATGGTGGAAGGCAAAAGG + Intergenic
932144954 2:69308354-69308376 AAAGTTTAGTGGAAAGGAGATGG + Intergenic
932644939 2:73490316-73490338 CTATTTTAGCAGAAGGTAGAAGG + Exonic
933000272 2:76912853-76912875 CAAACTTGGTGGAAGGCAAAGGG - Intronic
933113664 2:78437714-78437736 CAATTATGGTGGAAGACAAAAGG - Intergenic
933209596 2:79551728-79551750 CAATCATGGTGGAAGGCAAAGGG + Intronic
933402598 2:81818359-81818381 CAATTTTGGTGGAAGGTGAAGGG + Intergenic
933633802 2:84684848-84684870 TAATCTTAGTAGAAGCCAGAAGG + Intronic
934054856 2:88243048-88243070 CAATCATGGTGGAAGGCAAAAGG - Intergenic
934131830 2:88955990-88956012 CAATTTTTGTGGAAGGGTCATGG - Intergenic
934473222 2:94574498-94574520 CAATCATGGTGGAAGGCAAAGGG - Intergenic
934926545 2:98385804-98385826 CAATCATGGTGGAAGGCAAAGGG + Intronic
934988675 2:98905329-98905351 CAAGCATGGTGGAAGGCAGAGGG - Intronic
935425650 2:102916202-102916224 CAATCATGGTGGAAGGCAAAGGG + Intergenic
935425908 2:102918092-102918114 CAATTATGGTGGAAGGCAAAAGG + Intergenic
935498478 2:103809689-103809711 CAATCATGGTGGAAGGCAAAAGG - Intergenic
935798605 2:106670187-106670209 CAATCATGGTGGAAGGCAAAGGG - Intergenic
935883004 2:107585372-107585394 CAATCATGGTGGAAGGCAAAAGG + Intergenic
936233292 2:110723026-110723048 CAATCATGGTGGAAGGCAAAGGG - Intergenic
936257190 2:110927083-110927105 CAATCATGGTGGAAGGCAAAGGG + Intronic
936330571 2:111544216-111544238 CAATTATGGTGGAAGGCGAAGGG - Intergenic
936647159 2:114385082-114385104 CTACTTTAGTAGAAGGCAGTTGG + Intergenic
936663791 2:114571351-114571373 CAATCATGGTGGAAGGCAAAAGG - Intronic
936732751 2:115404198-115404220 CAATCATGGTGGAAGGCAAAGGG + Intronic
936738617 2:115476335-115476357 CAATTATGGTGGAAGGCAAAGGG - Intronic
936752794 2:115666294-115666316 CAATCATGGTGGAAGGCAAAAGG + Intronic
936920301 2:117681767-117681789 CAATTATGGTGGGAGGCAAAGGG - Intergenic
936994839 2:118402630-118402652 CAATTATGGTGGAAGGCATAGGG - Intergenic
937178912 2:119971175-119971197 CAATCATGGTGGAAGGCAAAGGG + Intronic
937491245 2:122370751-122370773 CAATCATGGTGGAAGGCAAAGGG + Intergenic
937589152 2:123592491-123592513 CAATCATAGTGGAAGGCAAGAGG + Intergenic
937617901 2:123947954-123947976 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
937688621 2:124726448-124726470 CAATCTTAGGGGAAAGCAAATGG - Intronic
937742223 2:125368762-125368784 CAATCTTAGCAGAAGGCAAAGGG + Intergenic
937743795 2:125386972-125386994 AAAATTTAGTGGAAGACACAGGG - Intergenic
937864789 2:126741534-126741556 CAATCATGGTGGAAGGCAAAAGG - Intergenic
938141820 2:128800653-128800675 CAATCATGGTGGAAGGCAAAGGG + Intergenic
939073218 2:137568592-137568614 CAATCATGGTGGAAGGCAAAGGG + Intronic
939201790 2:139044772-139044794 CAATCATGGTGGAAGGCAAAAGG - Intergenic
939703392 2:145421508-145421530 CAATCATGGTGGAAGGCAAAAGG + Intergenic
939834507 2:147112161-147112183 CAATCATGGTGGAAGGCAAAGGG - Intergenic
939859908 2:147406807-147406829 CAATCATGGTGGAAGGCAAAAGG - Intergenic
939874421 2:147561076-147561098 CAATTTTAGTGCAAGTCTGCAGG + Intergenic
940127360 2:150341585-150341607 CAATTATGGTGGAAGGCAGAGGG - Intergenic
940162242 2:150725975-150725997 CAATCATGGTGGAAGGCAAAGGG + Intergenic
940164885 2:150760131-150760153 CAATCATGGTGGAAGGCAAAAGG - Intergenic
940272876 2:151910469-151910491 TAATTTTTGTGTAAGGCATAAGG + Intronic
941057716 2:160807452-160807474 CAATTATGGTGGGAGGCAAAAGG + Intergenic
941211735 2:162648227-162648249 CAATCATGGTGGAAGGCAAAGGG + Intronic
941468613 2:165858538-165858560 CAATAATGGTGGAAGGCAAAGGG + Intronic
941594267 2:167456178-167456200 CAATCATGGTGGAAGGCAAAGGG + Intergenic
941607807 2:167621835-167621857 CAATCATGGTGGAAGGTAGAAGG - Intergenic
941723112 2:168833357-168833379 CACGTTTAGAGGGAGGCAGAAGG + Intronic
941802454 2:169675433-169675455 CAATTGTGGCGGAAGGCAAAGGG + Intronic
942340353 2:174937833-174937855 CAGTCATGGTGGAAGGCAGAGGG - Intronic
942471507 2:176265471-176265493 CAATCATGGTGGAAGGCAAAGGG - Intergenic
943240664 2:185379482-185379504 TAATTTTTGTGTAAGGCATAAGG - Intergenic
943298610 2:186169274-186169296 CGATTTTAGTGAAATGCAGTTGG - Intergenic
943416481 2:187612485-187612507 CAATCATGGTGGAAGGCAAAGGG + Intergenic
943553466 2:189371142-189371164 CAATCATGGTGGAAGGCAAAGGG - Intergenic
943557656 2:189425855-189425877 CAATTATAGCAGAAGGCAAAGGG - Intergenic
943559864 2:189448079-189448101 CAATCATGGTGGAAGGCAAAAGG - Intronic
943603147 2:189944356-189944378 CAAACATAGTGGAAGGCAAACGG - Intronic
943619030 2:190126951-190126973 CAAGCTTAGTGGAAGCCAGCTGG + Intronic
943882532 2:193164310-193164332 CAATCATGGTGGAAGGCAAAGGG - Intergenic
944119551 2:196226287-196226309 CAATCATGGTGGAAGGCAAAGGG - Intronic
944160190 2:196651891-196651913 CAATCATGGTGGAAGGCAAAGGG + Intronic
944160452 2:196653944-196653966 CAATCCTGGTGGAAGGCAAAGGG + Intronic
944187728 2:196967979-196968001 CAGTTATGGTGGAAGGCAAAAGG - Intronic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
944479621 2:200143571-200143593 CAATCATAGTGGAAGGCAAAGGG + Intergenic
944594692 2:201250465-201250487 CAATTATGGTGGAAGACAAAGGG + Intronic
944880327 2:204006809-204006831 CAATCATGGTGGAAGGCAAAAGG + Intergenic
945149895 2:206779476-206779498 CAATTATGGCGGAAGGCAAAGGG + Intronic
945328877 2:208516152-208516174 CAATCATGGTGGAAGGCAAAGGG + Intronic
946384291 2:219373017-219373039 TTATTTTAGTGGAAGGAAGGAGG + Intergenic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
946526315 2:220524572-220524594 CAATCATGGTGGAAGGCAAAGGG + Intergenic
946550258 2:220793524-220793546 CAATAATGGTGGAAGGCAAAAGG - Intergenic
946743880 2:222826933-222826955 GAATTTTAGTGGAAGACATTGGG + Intergenic
946756069 2:222948917-222948939 CAATCATGGTGGAAGGCAAAAGG - Intergenic
946769649 2:223075774-223075796 CAATCATAGTGGAAGGCAAAGGG - Intronic
946784689 2:223230534-223230556 TAATTTTTGTGGGAGTCAGAGGG + Intergenic
946879556 2:224163371-224163393 CAATCATGGTGGAAGGCAAAAGG - Intergenic
946880022 2:224168055-224168077 CAATCATGGTGGAAGGCAAAGGG - Intergenic
946968390 2:225065019-225065041 CAATCATGGTGGAAGGCAAAGGG + Intergenic
947251152 2:228105791-228105813 CAATCATGGTGGAAGGCAAAAGG - Intronic
947951494 2:234151838-234151860 CAATCATGGTGGAAGGCAAAAGG + Intergenic
948210077 2:236186347-236186369 CAATCATGGTGGAAGGCAAAGGG - Intergenic
948658720 2:239493297-239493319 CAGTTGTGGTGGAAGGCAAACGG + Intergenic
1168844962 20:938068-938090 CAATCCTGGTGGAAGGCAGAGGG - Intergenic
1168868713 20:1110615-1110637 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1169047975 20:2551664-2551686 TAATTTTTGTGAAAGGCATAAGG + Intronic
1169052539 20:2593107-2593129 CAATCACAGTGGAAGGCAAAGGG + Intronic
1169313776 20:4571121-4571143 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1169322332 20:4644052-4644074 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1169509582 20:6249289-6249311 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1169656737 20:7932177-7932199 CAATCATGGTGGAAGGCAAAGGG - Intronic
1169890152 20:10443902-10443924 CAATCATGGTGGAAGGCAAAAGG - Intronic
1170318512 20:15068638-15068660 CAACCATAGTGGAAGGCAAAGGG - Intronic
1170710447 20:18786118-18786140 CAATCATGGTGGAAGGCAGGAGG + Intergenic
1170741971 20:19066145-19066167 CAATTATGGCGGAAGGCAAAAGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170911803 20:20579056-20579078 CAATTTTAGTGGCAGGTAACAGG + Intronic
1171237340 20:23537954-23537976 AAATTTGTGTGGTAGGCAGATGG - Intergenic
1171490868 20:25516158-25516180 CAATCATGGTGGAAGGCAAAGGG - Intronic
1171936832 20:31282610-31282632 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1172017763 20:31888752-31888774 CAATCATGGTGGAAGGCAAAGGG + Intronic
1172226438 20:33308063-33308085 CAATCATAGCGGAAGGCAAAGGG + Intronic
1172477616 20:35250693-35250715 CAATCGTAGTAGAAGGCAAAGGG + Intronic
1172734576 20:37116568-37116590 CAATCATGGTGGAAGGCAAAGGG - Intronic
1172943034 20:38667379-38667401 CAATTTAAGAGGAAGGGAAATGG - Intergenic
1172954156 20:38743683-38743705 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1173093755 20:40003283-40003305 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1173399180 20:42709466-42709488 CAATAATGGTGGAAGGCAAAAGG - Intronic
1173399476 20:42711505-42711527 CAATCATGGTGGAAGGCAAAGGG - Intronic
1173493375 20:43501324-43501346 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1173745570 20:45434230-45434252 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1174086244 20:48009969-48009991 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1174709146 20:52686667-52686689 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1175054420 20:56185254-56185276 CAATCATGGTGGAAGGCAAATGG - Intergenic
1175292298 20:57884060-57884082 TAATCATAGTGGAAGGCAAAGGG - Intergenic
1175622528 20:60461152-60461174 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1176933953 21:14845273-14845295 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1177085106 21:16694113-16694135 CAATCATAGAGGAAGGCAAAGGG + Intergenic
1177285296 21:19041311-19041333 CAATCACAGTGGAAGGCAAAAGG + Intergenic
1177319437 21:19501095-19501117 CAATTATAGCAGAAGGCAAAGGG + Intergenic
1177497485 21:21908939-21908961 CAATGTCAGTGGAAAACAGAAGG - Intergenic
1177592623 21:23191054-23191076 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1177597297 21:23261576-23261598 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1177603348 21:23344801-23344823 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1177675702 21:24295669-24295691 CAATTTTGGAGGTGGGCAGAGGG - Intergenic
1177686124 21:24439480-24439502 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1177765380 21:25451245-25451267 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1177786168 21:25674020-25674042 CAATTATGGTGGAAGGCAAAAGG - Intronic
1177866083 21:26514457-26514479 CATTTACAGTGGAAGGCAGAAGG - Intronic
1178000142 21:28152726-28152748 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1178201006 21:30405340-30405362 CAATCATGGTGGAAGGCAAAAGG - Intronic
1178261993 21:31108076-31108098 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1178406386 21:32326721-32326743 CAATTATGGTAGAAGGCAAAGGG - Intronic
1178729401 21:35085755-35085777 CAATCTTGGTGAAAGGCAGAGGG - Intronic
1178751061 21:35303469-35303491 CAATCATGGTGGAAGGCAAAGGG + Intronic
1178802342 21:35807824-35807846 CAATCATAGTGGAAGGCAAAGGG + Intronic
1179101787 21:38360804-38360826 CAATTATGATGGAAGGCAAAAGG - Intergenic
1179237190 21:39558293-39558315 CAATCATGGTGGAAGGCAAAAGG - Intronic
1179598414 21:42459287-42459309 CAAGTTTATTGGAAGTCTGAAGG - Intergenic
1180747065 22:18096961-18096983 CAGTCATAGTGGAAGGCAAAGGG + Exonic
1181507968 22:23374467-23374489 CAGGTTTAGTGGAAGGGAGTTGG - Intergenic
1181794097 22:25291302-25291324 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1181834093 22:25587852-25587874 CAATCATGGTGGAAGGCAAAGGG - Intronic
1182253560 22:29021281-29021303 CAGTTTTAGTAGATAGCAGAAGG + Intronic
1183266352 22:36828606-36828628 CAATCATAGTGGAAGGGCGAAGG + Intergenic
1183762582 22:39836863-39836885 CAATCATAGCGGAAGGCAAAGGG - Intronic
1184901523 22:47449284-47449306 CAACCACAGTGGAAGGCAGAGGG - Intergenic
1184937737 22:47737259-47737281 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1184982876 22:48106743-48106765 CAATCATGGTGGAAGGCAAAGGG + Intergenic
949097953 3:108828-108850 GAATCATAGTGGAAGGCAAAGGG + Intergenic
949135207 3:556242-556264 CAATTATGATGGAAGGCAAAGGG + Intergenic
949363842 3:3259583-3259605 CAGTACTAGTGGAAGGGAGAGGG - Intergenic
949850866 3:8418966-8418988 CAATCATAGTGGAAGGCAAAGGG - Intergenic
949889415 3:8722442-8722464 CAATCATGGTGGAAGGCAAAGGG - Intronic
950572385 3:13809455-13809477 CACTTTTGGGGGATGGCAGAGGG + Intergenic
950931020 3:16788939-16788961 CAATCATGGTGGAAGGCAAAGGG - Intergenic
951133505 3:19075991-19076013 CAATCATGTTGGAAGGCAGATGG - Intergenic
951401083 3:22231967-22231989 CAATCATGGTGGAAGGCAAAGGG - Intronic
951452376 3:22853759-22853781 CAATCATGGTGGAAGGCAAAAGG + Intergenic
951674432 3:25220675-25220697 CAATCATGGTGGAAGGCAAAGGG - Intronic
951760946 3:26146999-26147021 CAATCATGGTGGAAGGCAAAGGG - Intergenic
952080913 3:29756429-29756451 CAATCATAGTGGAAGGCAAAGGG + Intronic
952200247 3:31118888-31118910 AAATCATAGTGGAAGGCAAAAGG + Intergenic
952440639 3:33324469-33324491 TAATTTTAGTGTAAGGTATAAGG + Intronic
952575711 3:34772297-34772319 TAATTGTGGTGGAAGGCAAAAGG - Intergenic
952606042 3:35147423-35147445 CAATCATTGTGGAAGGCAAAAGG + Intergenic
952667517 3:35924304-35924326 CAATCATGGTGGAAGGCAAAGGG - Intergenic
953095164 3:39767797-39767819 CAATCATGGTGGAAGGCAAAGGG + Intergenic
953296929 3:41728335-41728357 CACTTATGGTGGAAGGCAAAGGG + Intronic
953327998 3:42029033-42029055 CAATCATGGTGGAAGGCAAAGGG + Intronic
953356563 3:42261118-42261140 CAATTCTATTGGAGGGCAGTGGG - Intronic
953360673 3:42293484-42293506 CAATCATGGTGGAAGGCAAAAGG - Intergenic
953804964 3:46060830-46060852 CAATTATGGTGGCAGCCAGATGG - Intergenic
954273222 3:49525476-49525498 CAATCATAGTGGAAAGCAAAGGG + Intronic
954901353 3:54022645-54022667 CAATCATGGTGGAAGGCAAAGGG + Intergenic
954948693 3:54449737-54449759 CAATCATGGTGGAAGGCAAAAGG - Intronic
954984084 3:54774338-54774360 CAATCATCGTGGAAGGCAAAGGG + Intronic
955031281 3:55222411-55222433 CAATGTCAGTGGAGGGCACATGG - Intergenic
955579021 3:60398730-60398752 CAAATTTTGTGGAAGGAATAAGG + Intronic
955699363 3:61668495-61668517 CCATTTTAGTAGAAAGCAAACGG + Intronic
955765913 3:62343745-62343767 CAATCATGGTGGAAGGCAAAGGG - Intergenic
956347671 3:68298746-68298768 CAATCATGGTGGAAGGCAAAGGG - Intronic
956537676 3:70296094-70296116 CAGTTTTAGTGGTAGGGAAAGGG + Intergenic
956867867 3:73387111-73387133 CAATCATGGTGGAAGGCAAAAGG - Intronic
956989458 3:74746716-74746738 CAATCATGGTGGAAGGCAAAGGG + Intergenic
957229040 3:77487651-77487673 CAATTAAATTGGAAGTCAGATGG - Intronic
957305907 3:78458650-78458672 CAATCATGGTGGAAGGCAAAAGG + Intergenic
957496967 3:81005567-81005589 CAATCATGGTGGAAGGCAAAGGG - Intergenic
958049695 3:88330133-88330155 CAATCATGGTGGAAGGCAAATGG + Intergenic
958464097 3:94437479-94437501 CAATCATGGTGGAAGGCAAAGGG - Intergenic
958604657 3:96341265-96341287 CAATCATAGCGGAAGGGAGAGGG - Intergenic
958611751 3:96435810-96435832 CATTTTACGTGGATGGCAGAAGG + Intergenic
958672033 3:97218428-97218450 CAATTGTGGCGGAAGGCAAAAGG + Intronic
958845319 3:99258928-99258950 AAATCTTTGTGGGAGGCAGAGGG + Intergenic
959014657 3:101120440-101120462 CAATCATGGTGGAAGGCAAAGGG + Intergenic
959167534 3:102799326-102799348 CAATCATGGTGGAAGGCAAAGGG + Intergenic
959202789 3:103270613-103270635 CAATCATGGTGGAAGGCAAAAGG + Intergenic
959319234 3:104849200-104849222 CATTTTAAGTGGATGGCAGCAGG - Intergenic
959466123 3:106690134-106690156 CAATCATGGTGGAAGGCAAAGGG + Intergenic
959699199 3:109282395-109282417 CAATCATGGTGGAAGGCAAATGG + Intergenic
959886799 3:111511957-111511979 CAATTGTGGTGGAAGGCAAAGGG - Intronic
959955609 3:112234644-112234666 TAATTTTTGTGTAAGGCATAAGG + Intronic
960134121 3:114088701-114088723 CAATTGTGGTGGCAGGCAAAGGG + Intergenic
960219304 3:115085912-115085934 AAATTTGAGTGCAAGGGAGATGG - Intronic
960256620 3:115517493-115517515 CAATCATGGTGGAAGGCAAAGGG + Intergenic
960371915 3:116851004-116851026 CAATCATGGTGGAAGGCAAAGGG - Intronic
960399612 3:117180301-117180323 CAATTATGGTGGAAGGCAAAGGG + Intergenic
960400937 3:117197877-117197899 AAATTTTAATGGAAGGGAAATGG + Intergenic
960447618 3:117766775-117766797 CAATCATGGTGGAAGGCAAAGGG - Intergenic
960498828 3:118410245-118410267 CAATCATGGTGGAAGGCAAAGGG - Intergenic
960541837 3:118870374-118870396 CAATCATAGTGGAAAGCAAAGGG - Intergenic
960724887 3:120660113-120660135 CAATCATGGTGGAAGGCAAAGGG - Intronic
960849292 3:122035670-122035692 CAATCATGGTGGAAGGCAAAGGG - Intergenic
961315153 3:126029420-126029442 CAATTATGGTGGGAGACAGAAGG - Intronic
961338926 3:126204275-126204297 CAATCATGGTGGAAGGCAAAGGG + Intergenic
961644708 3:128386695-128386717 CAATCATTGTGGAAGGCAAAGGG + Intronic
962121569 3:132565825-132565847 CAATCATAGTGGAAGGTAAAGGG - Intronic
962828601 3:139120628-139120650 CCATAGTAGTGGCAGGCAGAAGG + Intronic
963064428 3:141252427-141252449 CAATCATGGTGGAAGGCAAAGGG + Intronic
963312534 3:143724302-143724324 CAATCATGGTGGAAGGCAAAGGG - Intronic
963329927 3:143902979-143903001 CAATCTTGGTGGAAGGCATAGGG + Intergenic
963349123 3:144131509-144131531 CAATGATGGTGGAAGGCAAAAGG + Intergenic
963516250 3:146312549-146312571 CAATCATGGTGGAAGGCATAGGG - Intergenic
963903438 3:150754290-150754312 CAATCATGGTGGAAGGCAAAGGG + Intronic
963982294 3:151552203-151552225 CAATCACAGTGGAAGGCATAGGG - Intergenic
963997363 3:151725324-151725346 CAATTGTGGTGGAAGGCAAAGGG + Intergenic
964204852 3:154162297-154162319 TGATTTAAGTGGAAGGGAGATGG + Intronic
964213441 3:154253303-154253325 CATTTTTGGTGTAAAGCAGAAGG - Intronic
964507180 3:157412092-157412114 CAATCATGGTGGAAGGCAAAGGG - Intronic
964628961 3:158788453-158788475 CAATCACAGTGGAAGGAAGAGGG + Intronic
964897344 3:161613810-161613832 CAATCTTGGTGGAAGGTAGAAGG - Intergenic
964928713 3:161988991-161989013 CATTATAAGTGGAAGGCAGAAGG - Intergenic
965040597 3:163501445-163501467 CAATCATGGTGGAAGGCAAAGGG + Intergenic
965182159 3:165417688-165417710 CAATCATGGTGGAAGGCAAAAGG - Intergenic
965510770 3:169566004-169566026 CAATTGTGGTGGAAGGCGAAGGG + Intronic
965562214 3:170072594-170072616 CAGTCATGGTGGAAGGCAGAGGG + Intronic
965854819 3:173074546-173074568 CAATCATGGTGGAAGGCAAAAGG - Intronic
966076840 3:175946639-175946661 CAATCATGGTGGAAGGCAAAGGG + Intergenic
966273283 3:178134729-178134751 CAATCATGGTGGAAGGCAAAGGG + Intergenic
966346265 3:178983946-178983968 CAACCATAGTGGAAGACAGAGGG - Intergenic
966439333 3:179926444-179926466 GAGTTCTGGTGGAAGGCAGAAGG - Intronic
967229095 3:187320722-187320744 CAATTTTCCTGGAAGGCTCAGGG - Intergenic
967230423 3:187332636-187332658 CATTTTAACTGGAAGGCAGAGGG - Intergenic
967396450 3:189014751-189014773 CAATCATAGTGGAAGGCAAAGGG - Intronic
967567539 3:190989445-190989467 CAATCATGGCGGAAGGCAGAGGG - Intergenic
967586214 3:191217105-191217127 CAATCATGGTGGAAGGCAAAGGG + Intronic
967602300 3:191404604-191404626 CAGTTATCGTGGAAGGCAAAGGG + Intergenic
967656267 3:192053544-192053566 CAATTATGGTGGAAGACAAAAGG + Intergenic
968032444 3:195511983-195512005 CAATCATGGTGGAAGGCAAAGGG + Intergenic
969103769 4:4789673-4789695 TAATCATAGTGGAAGGCAAAGGG - Intergenic
969140495 4:5067106-5067128 CAATTATGGTGGAAGGCAAAAGG + Intronic
969198313 4:5581021-5581043 CAATTATGGCAGAAGGCAGAGGG - Intronic
969565800 4:7977221-7977243 CAATCATGGTGGAAGGCAAAGGG - Intronic
969913549 4:10466998-10467020 CAATCATGGTGGAAGGCAAAGGG + Intergenic
969947733 4:10801686-10801708 CAATCATGGTGGAAGGCAAAGGG + Intergenic
970107144 4:12597171-12597193 CAATTATGGTGGAAGGCAAAAGG - Intergenic
970107571 4:12602343-12602365 CAATCATGGTGGAAGGCAAAAGG + Intergenic
970123164 4:12779862-12779884 CAATCATGGTGGAAGGCAAAGGG - Intergenic
970255502 4:14165374-14165396 AAATTTCAGTGGAAGACAGGGGG - Intergenic
970301656 4:14687379-14687401 CAATCATGGTGGAAGGCAAAGGG - Intergenic
970363743 4:15337196-15337218 CAATCATGGTGGAAGGCAAAAGG + Intergenic
970369509 4:15393186-15393208 CAATCATGGTGGAAGGCAAAAGG - Intronic
970399012 4:15700323-15700345 CAAATGTGGTGGAAGGCAAAGGG + Intronic
970560721 4:17279670-17279692 CAATCATGGTGGAAGGCAAAAGG + Intergenic
970638334 4:18035446-18035468 CAATCATGGTGGAAGGCAGCAGG + Intergenic
970649096 4:18157957-18157979 CAATCATAGTGGAAAGCAAAAGG - Intergenic
970702778 4:18762595-18762617 CAAGTTTAGAGGAAGGGAGGAGG + Intergenic
970733713 4:19140652-19140674 TAATCATGGTGGAAGGCAGAGGG + Intergenic
971262184 4:25067160-25067182 CAATCATGGTGGAAGGCAAAAGG - Intergenic
971494568 4:27250405-27250427 CAATCATGGTGGAAGGCAAAGGG + Intergenic
971531458 4:27694170-27694192 CCATTTTACTGGAAGGCGTATGG + Intergenic
971545325 4:27879060-27879082 CAATCATGGTGGAAGGCAAAGGG + Intergenic
971562263 4:28095145-28095167 CAATCATGGTGGAAGGCAAAGGG + Intergenic
971597772 4:28553917-28553939 CAACTGTGGTGGAAGGCAAAGGG + Intergenic
971649839 4:29257537-29257559 CAATCATGGTGGAAGGCAAAAGG - Intergenic
971683836 4:29738208-29738230 CAATCATGGTGGAAGGCAAAAGG - Intergenic
971748031 4:30610696-30610718 CAATCATGGTGGAAGGCAAAGGG + Intergenic
971748194 4:30611880-30611902 CAATCATGGTGGAAGGCAAAGGG - Intergenic
971860110 4:32090816-32090838 CACTTCTAGTGGAAGGCTAAAGG + Intergenic
971902245 4:32676570-32676592 CAATTATGGTGGAAGGCAAAGGG + Intergenic
971943369 4:33243170-33243192 CAATCACAGTGGAAGGCAAAGGG - Intergenic
972129313 4:35810202-35810224 CACTTTTCTTGGAAGGGAGATGG + Intergenic
972161923 4:36237607-36237629 CAATCATTGTGGAAGGCAAAGGG - Intronic
972355294 4:38274843-38274865 CAATCATGGTGGAAGGCAAAGGG - Intergenic
973028148 4:45300035-45300057 CAATTATAGTGGAAGACCAAGGG - Intergenic
973091127 4:46137611-46137633 CAATCATGGTGGAAGGCAAAGGG - Intergenic
973266956 4:48220534-48220556 CAATCATGGTGGAAGGCAAAGGG - Intronic
973614394 4:52664165-52664187 CAATCATGGTGGAAGGCAAACGG - Intergenic
973670040 4:53207813-53207835 CAATCATGGTGGAAGGCAGAGGG - Intronic
973885164 4:55313515-55313537 CAATCATGGTGGAAGGCAAAAGG - Intergenic
973976095 4:56264043-56264065 CAATCATGGTGGAAGGCAAAGGG + Intronic
974131439 4:57761201-57761223 CAATCATGGTGGAAGGCAAAGGG + Intergenic
974229908 4:59097588-59097610 CAATTTGAGAGGAAAGCAAACGG - Intergenic
974259652 4:59509347-59509369 CAATTATGGTGAAAGGCAAAGGG - Intergenic
974516599 4:62922485-62922507 CAATCATGGTGGAAGGCAAAGGG + Intergenic
974606210 4:64155790-64155812 CAATCATGGTGGAAGGCAAAAGG + Intergenic
974769541 4:66393746-66393768 CAATCATGGTGGAAGGCAAAGGG + Intergenic
974964100 4:68738605-68738627 CAATCATAGTGGAAGGCAAAAGG + Intergenic
975071712 4:70148026-70148048 GAATTTTAGTGGATGGGAGTGGG - Intronic
975195040 4:71514371-71514393 CAATCATAATGGAAGGCAAACGG - Intronic
975302185 4:72802862-72802884 CAATTATGGTGGAAGGCAAAGGG + Intergenic
975334210 4:73156719-73156741 CAATCATGGTGGAAGGCAAAGGG - Intronic
975903331 4:79179888-79179910 CAATCATAGCGGAAGGCACAGGG + Intergenic
976009278 4:80467812-80467834 CAATTATGGTGGAAGGCAAAGGG + Intronic
976444950 4:85119007-85119029 CAATCATGGTGGAAGGCAAAAGG - Intergenic
976542381 4:86293691-86293713 CAATCATAGTGGAGGGCAAAGGG + Intronic
976550479 4:86389216-86389238 CAATCATGGTGGAAGGCAAAGGG - Intronic
976565724 4:86548597-86548619 CAATCATGGTGGAAGGCAAAGGG - Intronic
976649409 4:87418955-87418977 CAATCATGGTGGAAGGCAAAGGG + Intergenic
976902689 4:90198192-90198214 CAACTTCAGGGGAAGGAAGAAGG - Intronic
977072340 4:92407025-92407047 CAATTATAGTGGAAAGCGAAGGG + Intronic
977371668 4:96145032-96145054 CAATCATGGTGGAAGGCAAAGGG + Intergenic
977452664 4:97219123-97219145 CAATCATGGTGTAAGGCAGAGGG + Intronic
977675718 4:99744652-99744674 CAATCCTGGTGGAAGGCAAAAGG + Intergenic
977728716 4:100326611-100326633 CAATCATGGTGGAAGGCAAAAGG + Intergenic
977973204 4:103234095-103234117 CAATAATGGTGGAAGGCAGAAGG - Intergenic
978160157 4:105537120-105537142 CAATCATGGTGGAAGGCAAAGGG - Intergenic
978358682 4:107905202-107905224 CAATCATGGTGGAAGGCAAAAGG + Intronic
978465528 4:109004715-109004737 CAATCATAGTGGAAGGCAAAGGG - Intronic
978894407 4:113870145-113870167 CAATTATAGCAGAAGGCAAAGGG - Intergenic
979093757 4:116519025-116519047 CAATCATGGTGGAAGGCAAAAGG + Intergenic
979182736 4:117752246-117752268 CAATCGTGGTGGAAGGCAAAAGG - Intergenic
979253037 4:118585219-118585241 CACTCATAGTGGAAGGCAAAGGG + Intergenic
979352629 4:119662947-119662969 CAATCATGGTGGAAGGCAAAGGG - Intergenic
979739990 4:124137620-124137642 CAATTATGGTGGAAGGCAAAAGG - Intergenic
979781303 4:124654150-124654172 CAATCATGGTGGAAGGCAAAGGG - Intergenic
979793807 4:124818841-124818863 CAATCATGGTGGAAGGCAAAGGG - Intergenic
979821234 4:125174881-125174903 CAATCATGGTGGAAGGCAAAGGG + Intergenic
979894055 4:126135504-126135526 CAGTTATAATGGAAGGCAAAGGG - Intergenic
980009232 4:127577984-127578006 CAATCATGGTGGAAGGCAAAGGG + Intergenic
980065902 4:128187944-128187966 CAATCATGGTGGAAGGCAGGGGG - Intronic
980327131 4:131361043-131361065 CAATCTTGGCGGAAGGCAAAGGG + Intergenic
980399549 4:132262943-132262965 CAGTTATAGTGGAAGGCCAAGGG - Intergenic
980400649 4:132280244-132280266 CCATGATAGTGGAAGGCAAAGGG - Intergenic
980426955 4:132637656-132637678 CAATCATGGTGGAAGGCAAAGGG - Intergenic
980874989 4:138652463-138652485 CAATCATGGTGGAAGGCAAAGGG - Intergenic
980942129 4:139284741-139284763 CAATTATGGTGGAAGGCAAAGGG - Intronic
981041615 4:140228019-140228041 CATTTATGGTGGAAGGCAAAGGG - Intergenic
981322700 4:143411091-143411113 CAATGTGGTTGGAAGGCAGAGGG + Intronic
981453479 4:144926785-144926807 CAATCATAGTGGAAGGCAAAGGG - Intergenic
981608106 4:146562302-146562324 GAATTTCAGTAGAAGGCAGAGGG - Intergenic
981698239 4:147580525-147580547 CAATCATGGTGGAAGGCAAAGGG + Intergenic
981795253 4:148588593-148588615 CAATTATGGTGGAAGGTAAAAGG - Intergenic
981805161 4:148706943-148706965 CAATCATGGTGGAAGGCAAAGGG - Intergenic
981813259 4:148799485-148799507 AAGTTTTAGTGGGAGGCACAAGG + Intergenic
982299763 4:153866807-153866829 CAATCATGGTGGAAGGCAAAAGG - Intergenic
982486211 4:155968661-155968683 CTTTCATAGTGGAAGGCAGAGGG - Intergenic
982490250 4:156021017-156021039 CAATCATGGTGGAGGGCAGAGGG - Intergenic
982505414 4:156211174-156211196 CAATCATGGTGGAAGGCAAAGGG + Intergenic
982607528 4:157533495-157533517 CAATCATGGTGGAAGGCAAAAGG - Intergenic
982862323 4:160468473-160468495 CAATTTAAGCAGAAGGCAAAGGG + Intergenic
983320386 4:166189680-166189702 GAATTTTATTGGATGACAGAAGG + Intergenic
983378990 4:166967571-166967593 CAATCATGGTGGAAGGCTGAAGG - Intronic
983490629 4:168385187-168385209 CAATTTCTGGGGAAGGGAGAAGG + Intronic
983504357 4:168536547-168536569 CAATTATGGCGGAAGGCAAAGGG + Intronic
983529104 4:168791434-168791456 CAATCATGGTGGAAGGCAAAGGG + Intronic
983670494 4:170231649-170231671 CAATCATGGTGGAAGGCAAAGGG - Intergenic
983732552 4:171013157-171013179 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
983917825 4:173311501-173311523 CAATTATAGTGGAATGCAAAGGG + Intronic
984057131 4:174943462-174943484 CAACTATGGTGGAAGGCAAAGGG + Intronic
984057835 4:174950940-174950962 CAATCATGGTGGAAGGCAAAGGG - Intronic
984116948 4:175694030-175694052 CAATTATGGTGGAAGGCAAAAGG - Intronic
984355773 4:178655254-178655276 CAATTATAGTAGAAGGTAAAGGG - Intergenic
984388714 4:179099616-179099638 CAATCATGGTGGAAGGCAAAAGG + Intergenic
984447182 4:179851357-179851379 CAATTATGGTGGAAGACACAAGG - Intergenic
984485807 4:180367647-180367669 CAATTTTATGAGAAGGCTGATGG + Intergenic
984513926 4:180714738-180714760 CAATCATGGTGGAAGGCAAAAGG - Intergenic
984572040 4:181405728-181405750 CAATTATGGTGGAAGGCAAAGGG + Intergenic
984786642 4:183573433-183573455 CAATCATAGTGGAAGGCAAATGG + Intergenic
985243007 4:187950772-187950794 CAATCATGGTGGAAGGCAAAGGG + Intergenic
985808370 5:2065225-2065247 CAATTATGGCGGAAGGCAAAAGG - Intergenic
985853086 5:2403054-2403076 CAATCATGGTGGAAGGCAAAAGG - Intergenic
985919788 5:2961257-2961279 CAATTATGGTGGAAGGTAAAAGG + Intergenic
986099606 5:4595073-4595095 CAATCATGGTGGAAGGCAAAGGG - Intergenic
986159434 5:5213074-5213096 CAATGATAGTGCAAGGAAGAGGG - Intronic
986242211 5:5971222-5971244 CAATCATGGTGGAAGGCAAAGGG + Intergenic
986360862 5:6976467-6976489 CAATTATGGTAGAAGGCAAAGGG - Intergenic
986581516 5:9271227-9271249 CAATTATGGTGGAAGGCAAAGGG - Intronic
986650873 5:9962175-9962197 CAATTATGGTGGAAGGCACAGGG + Intergenic
986793485 5:11186610-11186632 CAATTACAGTGGACTGCAGAGGG - Intronic
986982780 5:13468564-13468586 CAATCATGGTGGAAGGCAAAGGG + Intergenic
987020659 5:13867454-13867476 CAATCATGGTGGAAGGCAAAGGG - Intronic
987432877 5:17857980-17858002 CAATTATGGTGGAAGGCAAAGGG - Intergenic
987564494 5:19566495-19566517 CAATCATGGTGGAAGGCAAAAGG + Intronic
987636078 5:20544518-20544540 CAATCATATTGGAAGGCAAAGGG + Intronic
987693861 5:21302687-21302709 CAATTGTAGTGGAAGGTGAAAGG - Intergenic
987740356 5:21900241-21900263 CAATTCCTGTGGAAGGCAGGAGG + Intronic
987843886 5:23256600-23256622 CATTTTTGGCAGAAGGCAGAAGG - Intergenic
987967783 5:24897701-24897723 CAATCATTGTGGAAGGCAAAGGG - Intergenic
988234774 5:28528050-28528072 CAATCATTGTGGAAGGCAAAAGG - Intergenic
988272198 5:29031931-29031953 CAATCATGGTGGAAAGCAGAGGG + Intergenic
988461735 5:31445002-31445024 CAATTTTTGTGGAGGCCAGTGGG + Intronic
988473668 5:31564381-31564403 CAATCATAGTGGAAGACAAAGGG + Intergenic
988580069 5:32460994-32461016 CAATCATGGTGGAAGGCAAAGGG - Intergenic
988680040 5:33475952-33475974 CAATCATGGTGGAAGGCAAAGGG - Intergenic
988778610 5:34499218-34499240 CAATCATGGTGGAAGGCAAAGGG - Intergenic
988884650 5:35542958-35542980 CATTTTAAGAGGAAGGCAGAGGG + Intergenic
989067486 5:37478917-37478939 CAGTTTTAGTGGAATGGTGAGGG + Intronic
989246623 5:39262526-39262548 CAACTTTTGTAGAAGGCTGATGG + Intronic
989361903 5:40611148-40611170 CAATCATGGTGGAAGGCAAAAGG + Intergenic
989439605 5:41454920-41454942 CAATCATAGTGGAAGGCGAAGGG + Intronic
990010673 5:50993930-50993952 CAATCATGGTGGAAGGCAAATGG - Intergenic
990364617 5:55057714-55057736 TAAATTTAGTGGGAGACAGAGGG + Intergenic
990450275 5:55926925-55926947 CAATCATGGTGGAAGGCAAAAGG + Intergenic
990578703 5:57148425-57148447 CAATCATGGTGGAAGGCAGAGGG - Intergenic
990689353 5:58346323-58346345 CACTTTTCATGCAAGGCAGAAGG + Intergenic
990815938 5:59784952-59784974 CAATCATGGTGGAAGGCAAAAGG - Intronic
990864813 5:60368824-60368846 CAATCATAGTGGAAGGCAAGGGG - Intronic
991028601 5:62058488-62058510 CAATTGTAGCAGAAGGCAAAGGG + Intergenic
991042687 5:62192268-62192290 CAATCATAGTGGAAGGCCAAGGG - Intergenic
991364416 5:65853463-65853485 CAATCATGGTGGAAGGCAAAGGG - Intronic
991636015 5:68706737-68706759 CAATCATGGTGGAAGGCAAAGGG + Intergenic
992138234 5:73769016-73769038 CAATCATGGTGGAAGGCAAAAGG - Intronic
992376295 5:76191111-76191133 CAATCATGGTGGAAGGCAAAGGG + Intronic
992424950 5:76647595-76647617 CAATCATGGTGGAAGGCAAAAGG - Intronic
992914178 5:81431917-81431939 CAATTTTTGAGGATGGGAGAAGG - Intronic
993024299 5:82627747-82627769 CAATCATTGTGGAAGGCAAAAGG - Intergenic
993084463 5:83347421-83347443 CAATCATGGTGGAAGGCAAAAGG + Intronic
993362194 5:86991253-86991275 CAATCCTGGTGGAAGGCAAAGGG - Intergenic
993468488 5:88277244-88277266 CAATCATGGTGGAAGGCAAAGGG - Intergenic
993725549 5:91362594-91362616 CAATCATAGTGGAAGGCAAATGG + Intergenic
994060893 5:95475478-95475500 CAATCATGGTGGAAGGCAAAGGG - Intronic
994223635 5:97226283-97226305 CAACTTTAGTCCAAAGCAGAGGG + Intergenic
994474371 5:100248797-100248819 CAATCATGGTGGAAGGCAAAGGG - Intergenic
994585468 5:101703645-101703667 CAATTATGGTGAAAGGCAAAGGG + Intergenic
994649219 5:102505284-102505306 CAATCATGGTGGAAGGCAAAAGG - Intergenic
994715693 5:103318943-103318965 CAATCACAGTGGAAGGCAAAGGG - Intergenic
994898980 5:105745666-105745688 CAATTATGGTGGAAGCCAAAGGG + Intergenic
995051266 5:107707233-107707255 CACTTTCACTGGAAGGTAGAAGG + Intergenic
995155836 5:108912093-108912115 CAATTATGGTGGAAGGCAGAAGG - Intronic
995399258 5:111721792-111721814 CAATTATGGTAGAAGGCAAAGGG - Intronic
995587122 5:113659734-113659756 CCTTTTTAGAGGGAGGCAGATGG + Intergenic
995820452 5:116224497-116224519 CAATCATGGTGGAAGGCAAAAGG + Intronic
996220583 5:120927288-120927310 CAATCATGGTGGAAGGCAAAGGG + Intergenic
996235690 5:121127015-121127037 CAATCATGGTGGAAGGTAGAGGG - Intergenic
996236750 5:121140611-121140633 CAATCATGGTGGAAGGCAAAAGG + Intergenic
996627496 5:125587262-125587284 CAATCATGGTGGAAGGCAAAGGG + Intergenic
996697896 5:126419254-126419276 CAATCATAGTGAAAGGCAAAGGG + Intronic
996857935 5:128030839-128030861 CAATCATTGTGGAAGGCAAAGGG - Intergenic
996917209 5:128726132-128726154 CAATCATGGTGGAAGGCAAAAGG + Intronic
997044108 5:130292690-130292712 CACTTACAGTGGAAGGCACAGGG - Intergenic
997182832 5:131849333-131849355 CAATTATGGTGAAAGGCAAAAGG - Intronic
997305890 5:132836166-132836188 CAATCATGGTGGAAGGCAAAGGG - Intergenic
997898290 5:137739955-137739977 CAATTGTGGTGGAAGGCAAAGGG - Intergenic
998294373 5:140952872-140952894 CAATCATGGTGGAAGGCAAAGGG + Intronic
998442432 5:142173774-142173796 CAATCATGGTGGAAGGCAAAGGG + Intergenic
998773045 5:145567759-145567781 CAATCATGGTGGAAGGCAAAGGG - Intronic
998795171 5:145811038-145811060 CAATCATGGTGGAAGGCAAAAGG + Intronic
999756081 5:154665488-154665510 CAATCATGGTGGAAGGCAAAGGG + Intergenic
999909367 5:156180828-156180850 CAAGTTAAGGGGAAGGCAAAGGG + Intronic
999948965 5:156628065-156628087 CAGTCATGGTGGAAGGCAGAGGG + Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000498107 5:162011397-162011419 AAATCTTGGTGGAAGGCAAAGGG + Intergenic
1000559384 5:162767109-162767131 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1000968872 5:167692025-167692047 CAATTATTCAGGAAGGCAGAGGG - Intronic
1001002379 5:168019677-168019699 CAATTTCAGTGGATGTCAGCTGG + Intronic
1001337875 5:170815458-170815480 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1001549601 5:172593499-172593521 CAGCTTTAGCGGGAGGCAGATGG + Intergenic
1001918439 5:175581435-175581457 CAGTTATGGTGGAAGGCAAAAGG + Intergenic
1001994138 5:176141781-176141803 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1002732701 5:181353430-181353452 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1002751837 6:120676-120698 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1002802019 6:532947-532969 CAGTCTTGGTGGAAGGCAAAGGG + Intronic
1003170242 6:3715884-3715906 CAATTTTAGTGGAGTGATGAGGG - Intergenic
1003389107 6:5698274-5698296 CAATCATGGTGGAAGGCCGAGGG + Intronic
1003718290 6:8671994-8672016 CAATCATAGTGGAAGGCAAAGGG + Intergenic
1003788903 6:9520456-9520478 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1003845549 6:10170691-10170713 CAATCGTAGTGGAAGGCAAAGGG + Intronic
1004103952 6:12645831-12645853 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1004185301 6:13416178-13416200 CAATCATGGTGGAAGGCAAAGGG - Intronic
1004201160 6:13549277-13549299 CAATTGTGGTGGAAGGCAAAGGG - Intergenic
1004522337 6:16373741-16373763 CAATCATGGTGGAAGGCAAAAGG - Intronic
1004627457 6:17390244-17390266 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1004756827 6:18619308-18619330 TAATCATAGTGGAAGGCTGAGGG + Intergenic
1004762116 6:18678598-18678620 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1004792163 6:19038640-19038662 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1004895857 6:20147115-20147137 CAATCATGGTGGAAGGCAAAAGG - Intronic
1005101259 6:22174404-22174426 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1005375737 6:25180512-25180534 AAATTTTAGTGCTAAGCAGAAGG + Intergenic
1005597925 6:27397208-27397230 CAATTATGGTGGAAGGTAAAGGG + Intronic
1005669976 6:28095588-28095610 CAATTATGGCAGAAGGCAGAGGG - Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1006364194 6:33605565-33605587 CAATCATGGTGGAAGGCAGAGGG + Intergenic
1006696961 6:35939503-35939525 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1006940616 6:37749651-37749673 AAATCATAGTGGAAGGCAAAGGG - Intergenic
1007182363 6:39938806-39938828 CAATTATGGTAGAAGGCAGAGGG + Intergenic
1008032057 6:46707606-46707628 CAATTATGGTGGAAGGCAACCGG - Intronic
1008045241 6:46845030-46845052 CAATCACAGTGGAAGGCAAAGGG - Intergenic
1008139797 6:47818869-47818891 CAAATATGGTGGAAGGGAGAGGG + Intronic
1009345673 6:62610902-62610924 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1009415822 6:63415427-63415449 CAATTATAGTGGAAGGCAAAGGG + Intergenic
1010032013 6:71281251-71281273 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1010526984 6:76912844-76912866 AATTTATAGTGGAAAGCAGAAGG - Intergenic
1010561669 6:77358658-77358680 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1010821577 6:80421256-80421278 CAATCATAATGGAAGGCAAAGGG - Intergenic
1010843937 6:80681490-80681512 CAATTTTTTTGGGAGGGAGATGG + Intergenic
1010875794 6:81103830-81103852 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1010938430 6:81887820-81887842 AAATCATGGTGGAAGGCAGAAGG + Intergenic
1010951737 6:82045097-82045119 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1011131731 6:84058905-84058927 CAGTTTTAGTGGAATGCTGGGGG + Intronic
1011134187 6:84081908-84081930 CAATTTTAGTGGAAGGCAGAGGG - Intronic
1011439005 6:87368385-87368407 CAATCATAGCGGAAGGCAAAAGG + Intronic
1012038206 6:94170102-94170124 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1012127667 6:95451552-95451574 CAATCATGGTGAAAGGCAGAAGG - Intergenic
1012156922 6:95830828-95830850 CAATTATGGTGGAAGGCAAAAGG + Intergenic
1012254580 6:97016947-97016969 CAATAATGGTGGAAGGCAAAGGG - Intronic
1012342249 6:98142164-98142186 CAATCATAGTGGAAGGCAAACGG + Intergenic
1012378139 6:98587162-98587184 CAATTTTAGTGGGAGACTGTGGG - Intergenic
1012397687 6:98818780-98818802 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1012499171 6:99869653-99869675 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1012594400 6:101023259-101023281 CAATCATCGTGGAAGGCAAAGGG - Intergenic
1012830931 6:104202537-104202559 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1012883071 6:104814845-104814867 CAATCATGGTGGAAGGCAAAGGG - Intronic
1013384755 6:109615274-109615296 ACATTTTAATAGAAGGCAGAAGG - Intronic
1013710131 6:112887636-112887658 CAATTGTGGTGGAAGGCAGAGGG + Intergenic
1014247602 6:119084025-119084047 CAATCATGGTGGAAGGCAAAGGG + Intronic
1014327471 6:120017429-120017451 GAATCATAGTGGAAGGCAAAAGG + Intergenic
1014327720 6:120019346-120019368 CAATCATAGTGGAAGGTAAAAGG + Intergenic
1014374903 6:120660254-120660276 CAATAATAGTGGAAGGGAAAGGG + Intergenic
1014581480 6:123142529-123142551 CAACTTTAGAGGAAGGGGGAGGG + Intergenic
1014587122 6:123212499-123212521 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1014714363 6:124847456-124847478 CAATTTTGGTGGAATGTTGAGGG - Intergenic
1014714711 6:124850109-124850131 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1015252426 6:131141349-131141371 TAATCATAGTGGAAGGCAAAGGG - Intronic
1015429567 6:133114445-133114467 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1015453476 6:133397761-133397783 CAATTATGGCGGAAGGCAAAAGG + Intronic
1015874269 6:137807227-137807249 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1016342460 6:143078572-143078594 CAATCGTGGTGGAAGGCAAAAGG + Intronic
1016524945 6:144991006-144991028 CAATTTCCCTGGCAGGCAGAAGG - Intergenic
1016693586 6:146966450-146966472 CACTCATAGTGGAAGGCAAAGGG - Intergenic
1016696094 6:146998239-146998261 AAATTTTTATGGAATGCAGAAGG - Intergenic
1016763839 6:147770220-147770242 CAATACTAATGGAAGGCAGCAGG - Intergenic
1016944688 6:149518707-149518729 GACTTTTAATGGCAGGCAGATGG - Intronic
1017123770 6:151047928-151047950 CAATCATGGTGGAAGGCAAAGGG + Intronic
1017241206 6:152171027-152171049 CAATTATGGTGGAAGGCGAAAGG - Intronic
1017313260 6:152999739-152999761 CAATCATGGTGGAAGGCAAAAGG - Intronic
1017339654 6:153305528-153305550 TAGTTATGGTGGAAGGCAGAGGG - Intergenic
1017687787 6:156930357-156930379 CAATCATGGTGGAAGGCAAAAGG - Intronic
1018320234 6:162600807-162600829 CAATTATGGTGGAAGGCGAAGGG - Intronic
1018602635 6:165561294-165561316 CAATCATGGTGGAAGGCAAAGGG - Intronic
1018674475 6:166207005-166207027 CAATCATAGTGGAAGGCAAAAGG - Intergenic
1018771387 6:166974137-166974159 CAATCATGGTGGAAGGCAGAGGG - Intergenic
1018923640 6:168192392-168192414 CATTCTTAGTGGAAGGGAGTTGG - Intergenic
1019061777 6:169262549-169262571 GTATTTCAGTGGAAGCCAGATGG - Intergenic
1019106889 6:169675338-169675360 CAATCATGGTGGAAGGCAAAGGG - Intronic
1019236956 6:170625748-170625770 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1019534463 7:1521544-1521566 CAATCATGGCGGAAGGCAGAAGG + Intergenic
1019824775 7:3275049-3275071 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1019969596 7:4529524-4529546 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1020233517 7:6338526-6338548 CATCTTTGGTGGGAGGCAGAGGG - Intronic
1020527581 7:9282148-9282170 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1020668093 7:11072817-11072839 CAATCATGGTGGAAGGCAAAGGG + Intronic
1020704468 7:11526745-11526767 CAATCATGGTGGAAGGCAAAGGG - Intronic
1020704689 7:11529646-11529668 CAATCATGGTGGAAGGCAAAGGG - Intronic
1020795301 7:12671616-12671638 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1020890875 7:13876512-13876534 CAATGATGGTGGAAGGCAAAGGG + Intergenic
1021083598 7:16392544-16392566 CAGTTTTGGTGGGAGGGAGAGGG + Intronic
1021479643 7:21102085-21102107 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1021529678 7:21631073-21631095 CAATTGTAGTGGAAGGTGAAAGG + Intronic
1021954463 7:25810408-25810430 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1022198483 7:28093364-28093386 CAATCATGGTGGAAGGCAGAAGG - Intronic
1022327755 7:29347459-29347481 CAATCATGGTGGAAGGCGGAGGG + Intronic
1022569415 7:31437007-31437029 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1022706117 7:32803519-32803541 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1022843189 7:34183985-34184007 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1022873417 7:34503306-34503328 CAATTATGGTGGAGGGCAAAGGG + Intergenic
1023139939 7:37091777-37091799 CAATCATGGTGGAAGGCAAAAGG + Intronic
1023793613 7:43772663-43772685 CAATTATGGTGGAAGGCAAAGGG + Intronic
1023803866 7:43857477-43857499 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1023857905 7:44196489-44196511 AACTTTCAGTGGAAGGAAGAGGG + Intronic
1023926136 7:44671194-44671216 CACTCCTAGTGGAAGGCAGAGGG + Intronic
1024050841 7:45622322-45622344 CAGGTCTAGTGGAGGGCAGATGG + Intronic
1024269828 7:47633949-47633971 TAATTTTAATGGAATGCATAAGG + Intergenic
1024914751 7:54486789-54486811 CAATTATGATGGAAGGCAAAAGG + Intergenic
1025110502 7:56212274-56212296 CAAGTATGGCGGAAGGCAGAAGG - Intergenic
1025987421 7:66465798-66465820 CAATCATAGTGGAAAGCAAAGGG - Intergenic
1026003705 7:66583407-66583429 CAATCATAGTGGAAAGCAAAGGG - Intergenic
1026185188 7:68077361-68077383 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1026229830 7:68473043-68473065 CAACTTTAGAGGAAGTCGGAAGG + Intergenic
1026307419 7:69154130-69154152 CAATCATGGTGGAAGGCAGAAGG + Intergenic
1026353197 7:69535278-69535300 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1026672939 7:72405410-72405432 CAATTATGGTGGAAGGCAAAGGG + Intronic
1026673242 7:72407575-72407597 CAATTATGGTGGAAGGCCAAGGG - Intronic
1027295021 7:76761227-76761249 CAATTTTGGTAGAAAGCTGAGGG - Intergenic
1027464992 7:78503847-78503869 CAATCATGGTGGAAGGCAAAGGG - Intronic
1027487960 7:78785793-78785815 CAATTTTAGAGAAAAGCTGAAGG + Intronic
1027696025 7:81411675-81411697 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1027707743 7:81555401-81555423 AAATCTTTGTGGGAGGCAGAGGG - Intergenic
1028265317 7:88716791-88716813 AAATATTAATGGAAGGCAAAAGG - Intergenic
1028535348 7:91885739-91885761 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1028544180 7:91979267-91979289 CAATCATGGTGGAAGGCAGAAGG + Intronic
1028656003 7:93207716-93207738 CAATTTTGGGGGAAAGAAGATGG + Intronic
1029030345 7:97460292-97460314 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1029593225 7:101521070-101521092 CAATCATGGTGGAAGGCAAAGGG + Intronic
1029981155 7:104880310-104880332 CAATCTTGGTGGAAGGTAAAGGG - Intronic
1030015117 7:105211497-105211519 CAATCATGGTGGAAGGCAAAGGG + Intronic
1030502406 7:110376435-110376457 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1030850906 7:114486214-114486236 CAATCATGGTGGAAGGCAAAGGG + Intronic
1030851186 7:114488106-114488128 CAATTACGGTGGAAGGCAAAGGG + Intronic
1031455811 7:121978432-121978454 CAATCATAGTGGAAAGCAAAGGG + Intronic
1031570797 7:123356797-123356819 CAATTTTAGTGGGATTCATAGGG + Intergenic
1031733106 7:125322408-125322430 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1032314126 7:130818797-130818819 TAATTTTAGAGGAAGCCAGGTGG - Intergenic
1032560862 7:132891915-132891937 CAATCATGGTGGAAGGCAAAGGG - Intronic
1032670209 7:134075450-134075472 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1032743426 7:134762610-134762632 CAATCCTGGTGGAAGGCAAAGGG + Intronic
1032792401 7:135252223-135252245 CAATCATGGTGGAAGGCAAAGGG + Intronic
1032856196 7:135835481-135835503 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1033071827 7:138209818-138209840 CAATTATGATGGAAGGCAAAGGG + Intergenic
1033434421 7:141320160-141320182 CAATCATGGTGGAAGACAGAGGG - Intronic
1033536614 7:142318280-142318302 CAATTTTAGGGGGAGTCAGATGG + Intergenic
1033784662 7:144716528-144716550 AAATTATGGTGGAAGGCAAAAGG - Intronic
1034100148 7:148443964-148443986 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1034100782 7:148448678-148448700 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1034144688 7:148858529-148858551 CAATTTTTTTGGAAGGGACAAGG + Intronic
1034903465 7:154922704-154922726 CAATCACAGTGGAAGGCAAAGGG - Intergenic
1034929206 7:155147956-155147978 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1035510814 8:180862-180884 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1035906757 8:3519845-3519867 CTATTTTAGTGGGAGGTTGATGG - Intronic
1036634497 8:10539738-10539760 CAATCATGGTGGAAGGCAAAAGG - Intronic
1037050961 8:14373685-14373707 CAATTTTGGTGGAATGCTGGGGG + Intronic
1037064170 8:14555481-14555503 CAATCATGGTGGAAGGCAAAGGG - Intronic
1037119508 8:15266323-15266345 CAATGATGGTGGAAGGCAAAGGG + Intergenic
1037125635 8:15345306-15345328 CTATCTAAGTGGAAGACAGAAGG - Intergenic
1037388011 8:18363962-18363984 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1037592496 8:20324702-20324724 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1037621315 8:20565969-20565991 CAATCATAGTGGAAGGCAAAAGG - Intergenic
1038578759 8:28728634-28728656 CACTTTTTTTGGAAGGCTGAGGG + Intronic
1038706431 8:29898232-29898254 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1038750871 8:30294613-30294635 CAATCATGGTGGAAGGGAGAGGG - Intergenic
1039115156 8:34084708-34084730 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1039178174 8:34833102-34833124 CAATTATGGTGGAAGGCGAAGGG - Intergenic
1039407128 8:37322943-37322965 CACTCATGGTGGAAGGCAGAGGG + Intergenic
1039574072 8:38609715-38609737 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1039667822 8:39555043-39555065 CAATTATGGCGGAAGGCAAAGGG - Intergenic
1039758734 8:40550722-40550744 CAATCATGGTGGAAGGCAAAGGG - Intronic
1039943501 8:42110860-42110882 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1040628866 8:49185063-49185085 CAATTATAGTGGAAGGCTAAGGG - Intergenic
1040687044 8:49886351-49886373 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1040799100 8:51321667-51321689 CAATCATGGTGGAAGGCAAAGGG - Intronic
1041013672 8:53569878-53569900 CAATCATAGTGGAAAGCAAAGGG - Intergenic
1041172833 8:55162632-55162654 CAATTGTAGTGGAAAGAACAGGG - Intronic
1041354840 8:56989524-56989546 CAATTTTTGTGGCTTGCAGAAGG + Intronic
1041445889 8:57950412-57950434 CAATCATGGTGGAAGGCAGAGGG + Intergenic
1041491648 8:58439066-58439088 CAATCACAGTGGAAGGCAAAAGG - Intronic
1041593645 8:59620752-59620774 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1041940537 8:63382324-63382346 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1042529331 8:69798439-69798461 CAATTACAGTGAAAGGCAAAGGG + Intronic
1042755137 8:72202179-72202201 CGATTATGGTGGAAGGCAAAGGG - Intergenic
1042770896 8:72381233-72381255 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1042893973 8:73645750-73645772 CAATCATGGTGGAAGGCAAAGGG + Intronic
1042968621 8:74383372-74383394 CAATTTCAGTGGAATGCATTTGG - Intronic
1043017417 8:74957285-74957307 CAATTTTAGTGGAATCACGAAGG - Intergenic
1043321191 8:78988837-78988859 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1043680672 8:83021485-83021507 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1043700321 8:83279129-83279151 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1043839934 8:85090690-85090712 CAATCATAGTGGAAGGCAAAAGG - Intergenic
1044076796 8:87831895-87831917 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1044193842 8:89351862-89351884 CAATTATAATGGAAGGCAAAAGG + Intergenic
1044345656 8:91101135-91101157 CAATAATGGTGGAAGGCAAAGGG - Intergenic
1044352170 8:91179271-91179293 CAATTGTGGTGGAAAGCAAAGGG + Intronic
1044714899 8:95091260-95091282 CAATCATGGTGGAAGGCAAAGGG + Intronic
1044941311 8:97347129-97347151 CAATCATAGTGGAAGGTAAAGGG + Intergenic
1045464874 8:102460597-102460619 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1045784164 8:105901832-105901854 CAATAATGGTGGAAGGCAAAGGG + Intergenic
1045942777 8:107757489-107757511 CAATTATGGTGGAAGACAAAGGG - Intergenic
1046093086 8:109526281-109526303 GAATCTTAATGGAAGGCATATGG + Intronic
1046331808 8:112726006-112726028 CAATTATGGCGGAAGGCAAAAGG + Intronic
1046517456 8:115281941-115281963 CAATCATGGTGGAAGGCAGAGGG + Intergenic
1046606168 8:116374392-116374414 CAATCATTGTGGAAGGCAAAAGG + Intergenic
1046692289 8:117299226-117299248 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1046826313 8:118695698-118695720 CAATCATGGCGGAAGGCAGAGGG + Intergenic
1046876343 8:119258968-119258990 CAATCATGGTGGAAGGCAAATGG + Intergenic
1046998286 8:120548178-120548200 CAATTATGATGGAAGGCAAATGG - Intronic
1047017197 8:120736052-120736074 CAATCATGGTGGAAGGCAAAGGG + Intronic
1047051771 8:121120738-121120760 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1047087898 8:121539599-121539621 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1047191089 8:122679607-122679629 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1047586786 8:126281924-126281946 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1047813286 8:128433977-128433999 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1047876790 8:129147570-129147592 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1047899624 8:129405939-129405961 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1047923235 8:129656804-129656826 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1047924649 8:129670581-129670603 TAATCTTGGTGGAAGGCAAAAGG - Intergenic
1048361887 8:133704544-133704566 ACATTTTCTTGGAAGGCAGATGG - Intergenic
1048576509 8:135694628-135694650 CAATCATGGCGGAAGGCAGAAGG + Intergenic
1048691671 8:136971943-136971965 CAATTGTGGTGGAAGGCAGTGGG - Intergenic
1048733440 8:137470488-137470510 CAATCATTGTGGAAGGCAAAGGG - Intergenic
1048737036 8:137513393-137513415 CAGTCATAGTGGAAGGCAAAAGG - Intergenic
1049485573 8:142858064-142858086 CAATCATGGTGGAAGGCAAAGGG + Intronic
1050128039 9:2379880-2379902 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1050187624 9:2991747-2991769 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1050411336 9:5368931-5368953 GAATTTTTGTGTAAGGCATAAGG - Intronic
1050569383 9:6921713-6921735 AAATTTTAATGGAAGCGAGATGG - Intronic
1050657478 9:7844961-7844983 CAATCATAGTGGAAGGCGAAGGG + Intronic
1050702388 9:8355237-8355259 GAAGTTTGGTGGAAGGCAAAAGG - Intronic
1051189110 9:14492516-14492538 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1051297918 9:15616998-15617020 CAATAATGGTGGAAGGCAAAGGG + Intronic
1052008751 9:23381793-23381815 CAATTATGGTGGAAGCCAAAGGG - Intergenic
1052067153 9:24036093-24036115 CAGTTCTACTGGAAGGCAGAAGG + Intergenic
1052090072 9:24316966-24316988 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1052287912 9:26807543-26807565 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
1052351906 9:27466648-27466670 GAATCATAGTGGGAGGCAGAAGG + Intronic
1052542556 9:29829075-29829097 CAATTATGGTGGAAGGCAAAGGG - Intergenic
1052969281 9:34367056-34367078 CAATCATGGTGGAAGGCAAAAGG + Exonic
1053109953 9:35450587-35450609 TAATTTTAGTTGAGTGCAGAGGG + Intergenic
1053125743 9:35579427-35579449 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1053356128 9:37447159-37447181 CAATCATGGTGGAAGGCAAAGGG + Intronic
1053470235 9:38341078-38341100 CAATTATGATGGAAGGCAAACGG + Intergenic
1053594629 9:39547031-39547053 CAATCACAGTGGAAGGCAAAAGG - Intergenic
1053852405 9:42302064-42302086 CAATCACAGTGGAAGGCAAAAGG - Intergenic
1053902716 9:42811021-42811043 CAATCATAGTGGAAAGCAAAGGG + Intergenic
1054571633 9:66817941-66817963 CAATCACAGTGGAAGGCAAAAGG + Intergenic
1054914544 9:70483742-70483764 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1054928425 9:70611494-70611516 CAATCATGGTGGAAGGCAAAGGG - Intronic
1054996640 9:71398618-71398640 CAATCATGGTGGAAGGCAAAGGG - Intronic
1055155644 9:73059720-73059742 CTATTTTAAAGAAAGGCAGAAGG + Intronic
1055180614 9:73381523-73381545 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1055189389 9:73498783-73498805 CAATCATGGTGTAAGGCAGAGGG - Intergenic
1055580928 9:77705617-77705639 CAAGTTCAGTGGAAAGCACATGG - Intergenic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1055833566 9:80411990-80412012 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1055856714 9:80697052-80697074 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1056036990 9:82617284-82617306 TAATTATGGTGGAAGGCAAAAGG + Intergenic
1056969259 9:91188922-91188944 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1058039401 9:100287683-100287705 CAATCATGGTGGAAGGCAAAGGG - Intronic
1058177530 9:101754924-101754946 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1058200070 9:102028176-102028198 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1058333170 9:103790410-103790432 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1058337669 9:103853183-103853205 CAATCATAGTGGAAAGCAAAGGG + Intergenic
1058802538 9:108558568-108558590 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1058852544 9:109026903-109026925 CAATCATGGTGGAAGGCAAAGGG - Intronic
1059050026 9:110914327-110914349 CAATCATGGTGGAAGGCAAAAGG + Intronic
1059779952 9:117515772-117515794 CCATTATGGTGGAAGGCAAAGGG + Intergenic
1059899991 9:118913426-118913448 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1060049230 9:120365548-120365570 CAATTGTGGTGGAAGGCAAAGGG + Intergenic
1060127943 9:121067827-121067849 AAATTATGGTGGAAGGCAAAGGG - Intergenic
1060264931 9:122106157-122106179 CAATCATGGCGGAAGGCAGAGGG + Intergenic
1060666422 9:125434757-125434779 GCATTTTAGGGGCAGGCAGATGG + Intergenic
1060755799 9:126212482-126212504 CAATCATAGAGGAAGGCAAAGGG - Intergenic
1060785412 9:126448624-126448646 CAATCATGGTGGAAGGCAAAGGG + Intronic
1060915086 9:127384134-127384156 CATTTTGAGAGGAAGGCAGAGGG + Intronic
1061189800 9:129075790-129075812 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1061891962 9:133626761-133626783 CAATCTTGGTGGAAGGTAAAGGG + Intergenic
1062344089 9:136106908-136106930 CAGTTTTGGTGGAAGGAACAGGG + Intergenic
1185754058 X:2638614-2638636 CAATCATGGCGGAAGGCAGAGGG - Intergenic
1185818991 X:3183764-3183786 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1185820134 X:3194947-3194969 CAATTATGGTGGAAGGGAAAGGG - Intergenic
1186051782 X:5604301-5604323 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1186121684 X:6370327-6370349 CTATTTTACTGGAAGGAAAAAGG - Intergenic
1186172529 X:6892417-6892439 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1186251211 X:7668866-7668888 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1186658757 X:11646057-11646079 CAATCATGGTGGAAGGCAAAGGG + Intronic
1186819687 X:13274709-13274731 CACTTTTGGTGGAAGGCACAGGG - Intergenic
1187132671 X:16517790-16517812 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1187277235 X:17826845-17826867 CAATTATGGTGGAAGGCAAGGGG - Intronic
1187299120 X:18030885-18030907 CAATCGTGGTGGAAGGCAAAGGG - Intergenic
1187757063 X:22539625-22539647 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1187882680 X:23861364-23861386 CAATCATGGTGGAAGGCAAAGGG - Intronic
1187883540 X:23867438-23867460 CAATCGTGGTGGAAGGCAAAGGG - Intronic
1188018812 X:25134794-25134816 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1188333454 X:28899069-28899091 CAATTATGGTGGAAGGCAAAGGG + Intronic
1188767236 X:34109255-34109277 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1188962501 X:36509085-36509107 CAATCATAGTGGAAGGTAAATGG + Intergenic
1188981002 X:36727026-36727048 CAATTTTAAGGGGAGGCAGAGGG - Intergenic
1189362815 X:40366438-40366460 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1189382339 X:40510967-40510989 CAATCATAGTAGAAGGCAAAAGG - Intergenic
1189553224 X:42114579-42114601 CAATCATAGTGGAAGTCAAAGGG + Intergenic
1189760291 X:44315196-44315218 CAATCATGGTGGAAGGCAAAGGG - Intronic
1189869435 X:45367047-45367069 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1189949435 X:46213705-46213727 CAATTATGGTAGAAGGCAAATGG + Intergenic
1189957546 X:46291212-46291234 CAATTATGGCAGAAGGCAGAGGG + Intergenic
1190895864 X:54617391-54617413 CAATTATAGTAGAGGGCAGAGGG - Intergenic
1191770961 X:64757811-64757833 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1191802288 X:65094149-65094171 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1191820257 X:65298829-65298851 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1192071970 X:67950418-67950440 AAATTATGGTGGAAGGCAAAGGG + Intergenic
1192270396 X:69574365-69574387 CAATCATAGTGGAGGGCAAAAGG + Intergenic
1192279091 X:69664420-69664442 CAATCATGGTGGAAGGCAAAGGG - Intronic
1192591340 X:72362320-72362342 CAATCATGGTGGAAGGCAAAGGG - Intronic
1193026937 X:76855061-76855083 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1193090862 X:77492719-77492741 CAATCATAGTGGAAGGCAAAAGG - Intergenic
1193121335 X:77825402-77825424 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1193226166 X:78986664-78986686 CAATAATTGTGGAAGGCAAAAGG + Intergenic
1193329789 X:80223267-80223289 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1193333118 X:80257138-80257160 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1193393219 X:80954218-80954240 CACTCTTGGTGGAAGGCAAAGGG - Intergenic
1193413762 X:81196928-81196950 CAATCATGGTGGAAGGCAAAGGG - Intronic
1193421705 X:81291317-81291339 CAATCATGGTGGAAGGCAAAGGG + Intronic
1193430890 X:81403209-81403231 AAATTATTGTGGAAGGCAAAAGG - Intergenic
1193527441 X:82611185-82611207 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1193577856 X:83225707-83225729 CAGCTATTGTGGAAGGCAGATGG - Intergenic
1193634476 X:83931268-83931290 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1193662631 X:84275329-84275351 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1193827164 X:86240901-86240923 CAATCATGGTGGAAGGCAAAGGG - Intronic
1193864184 X:86709381-86709403 TAATTTTTGTGAAGGGCAGATGG - Intronic
1193864442 X:86713182-86713204 CAATTTTAATGGGAGCTAGAAGG - Intronic
1193882930 X:86947609-86947631 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1193930153 X:87543102-87543124 CAATCATAGTGGAAGGCAAAGGG - Intronic
1194004573 X:88474715-88474737 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1194023965 X:88727769-88727791 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1194064325 X:89242596-89242618 CAACCATAGTGGAAGGCAAAGGG - Intergenic
1194119991 X:89950099-89950121 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
1194134885 X:90129490-90129512 CAATTATGGTGGAAAGCAAAGGG - Intergenic
1194306958 X:92259399-92259421 CAATCATGGTGGAAGGCAAAGGG + Intronic
1194388427 X:93286742-93286764 CAATCATGGTGGAAAGCAGAGGG + Intergenic
1194453357 X:94072313-94072335 CAATTATGGTGGAGGGCAAATGG - Intergenic
1194518200 X:94885333-94885355 CAATCATAGTGGAAGGCAAAAGG + Intergenic
1194590941 X:95798713-95798735 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1194686514 X:96924722-96924744 CAATTGTAGTGGGAGGCGAAGGG + Intronic
1194860203 X:98990318-98990340 CAATTATGGTGGAAGGCAAAGGG + Intergenic
1194864299 X:99047666-99047688 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1194876834 X:99200284-99200306 CAATTATGGTGGAAGGCAAAAGG - Intergenic
1194919615 X:99749365-99749387 CAATTATGGTGGAAGGCATGTGG - Intergenic
1195178191 X:102331244-102331266 CAATTATAGCAGAAGGCAAAGGG - Intergenic
1195180673 X:102355847-102355869 CAATTATAGCAGAAGGCAAAGGG + Intergenic
1195313500 X:103656216-103656238 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1195589319 X:106605838-106605860 GAAATTTAGTGCAAGGCAAAGGG + Intergenic
1195733857 X:107993045-107993067 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1195793350 X:108615215-108615237 CAATTTTAGATGAACTCAGAAGG - Intronic
1196091323 X:111746933-111746955 CAAATTGAGAGGAAGGCATAGGG + Intronic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1196473602 X:116057456-116057478 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1196829957 X:119768015-119768037 CAGTCATAGTGGAAGGCAAAGGG - Intergenic
1197314042 X:124941872-124941894 CAATCATGGTGGAAGGCAAAAGG + Intronic
1197417844 X:126196991-126197013 CAATTATGGTAGAAGGCAAAGGG - Intergenic
1197538153 X:127717828-127717850 AAAATTTGGTGGAAGGCAAAGGG + Intergenic
1197710210 X:129660633-129660655 CAATTATGGTGGAAGCCAAAGGG + Intergenic
1197715658 X:129704518-129704540 TCATTTTAGTGGAAGGCAAAGGG + Intergenic
1198057264 X:133007428-133007450 CAATTACGGTGGAAGGCAAAAGG - Intergenic
1198064049 X:133078164-133078186 CAATCATAGTGGAAGGCAAAGGG - Intronic
1198173960 X:134136129-134136151 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1198187398 X:134266902-134266924 CAATTGTGGTGGAAGGCAAAGGG + Intergenic
1198258671 X:134947198-134947220 AAATCATGGTGGAAGGCAGAGGG + Intergenic
1198260994 X:134964822-134964844 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1198305368 X:135376995-135377017 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1198564590 X:137891294-137891316 CAATTATGGTGGAAGGCGAAGGG + Intergenic
1198681155 X:139183614-139183636 CAATTATGGTGGAAGGCAAAGGG - Intronic
1198707054 X:139461108-139461130 CAATTGTGGTTGAAGGCAAAAGG - Intergenic
1198777806 X:140199415-140199437 CAATCATGGTGGAAGGCAAAAGG + Intergenic
1199118966 X:144028599-144028621 CAATTATGGTGGAAGGCAAATGG - Intergenic
1199226627 X:145383448-145383470 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1199230105 X:145426830-145426852 CAATCATAGTGGAAGGCAAAGGG - Intergenic
1199273962 X:145921015-145921037 CAATTATGGTGGAAGCCAAAGGG - Intergenic
1199296377 X:146163375-146163397 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1199301003 X:146213911-146213933 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1199346719 X:146748925-146748947 CAATCATGGTGGAAGGCAAAGGG + Intergenic
1199370365 X:147041412-147041434 CAATCATGGTGGAAGGCAAAAGG - Intergenic
1199380534 X:147167050-147167072 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1199421694 X:147651350-147651372 CAATTATGGTGGAAGGCTAAGGG - Intergenic
1199574406 X:149299567-149299589 CAATCATGGTGGAAGGCAAAGGG - Intergenic
1199749494 X:150801353-150801375 CGATCATAGTGGAAGGCAAAAGG + Intronic
1200315364 X:155127025-155127047 CAATCATGGTGGAAGGCAAAGGG - Intronic
1200319786 X:155175697-155175719 CAATCATGGTGGAAGGCAAATGG - Intergenic
1200384778 X:155879693-155879715 CAATCATGGTGGAAGGCAAACGG + Intergenic
1200472855 Y:3607616-3607638 CAATCGTGGTGGAAGGCAAAGGG + Intergenic
1200480671 Y:3699581-3699603 CAATTATGGTGGAAAGCAAAGGG - Intergenic
1202099095 Y:21287018-21287040 TAATTTTTGTGTAAGGCATAAGG - Intergenic