ID: 1011135618

View in Genome Browser
Species Human (GRCh38)
Location 6:84096837-84096859
Sequence GGGTAATTCTTGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011135613_1011135618 16 Left 1011135613 6:84096798-84096820 CCAAGCCAGTCAGGGTAAGATGG No data
Right 1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG No data
1011135611_1011135618 18 Left 1011135611 6:84096796-84096818 CCCCAAGCCAGTCAGGGTAAGAT No data
Right 1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG No data
1011135612_1011135618 17 Left 1011135612 6:84096797-84096819 CCCAAGCCAGTCAGGGTAAGATG No data
Right 1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG No data
1011135615_1011135618 11 Left 1011135615 6:84096803-84096825 CCAGTCAGGGTAAGATGGCTTCT No data
Right 1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011135618 Original CRISPR GGGTAATTCTTGAGAGAAGA AGG Intergenic
No off target data available for this crispr