ID: 1011139988

View in Genome Browser
Species Human (GRCh38)
Location 6:84142066-84142088
Sequence AGAAAAAAAGGCAGCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011139985_1011139988 -3 Left 1011139985 6:84142046-84142068 CCACATACATTTGAGACTAAAGA 0: 1
1: 0
2: 1
3: 10
4: 186
Right 1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG No data
1011139982_1011139988 0 Left 1011139982 6:84142043-84142065 CCCCCACATACATTTGAGACTAA No data
Right 1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG No data
1011139984_1011139988 -2 Left 1011139984 6:84142045-84142067 CCCACATACATTTGAGACTAAAG 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG No data
1011139983_1011139988 -1 Left 1011139983 6:84142044-84142066 CCCCACATACATTTGAGACTAAA 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG No data
1011139981_1011139988 24 Left 1011139981 6:84142019-84142041 CCTTCAAGGAGTTAACTAAAACA No data
Right 1011139988 6:84142066-84142088 AGAAAAAAAGGCAGCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011139988 Original CRISPR AGAAAAAAAGGCAGCCCAGA GGG Intronic