ID: 1011146204

View in Genome Browser
Species Human (GRCh38)
Location 6:84220022-84220044
Sequence GATAATGCACAGAGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011146204 Original CRISPR GATAATGCACAGAGGCAGGG AGG Intronic
900384413 1:2403076-2403098 GAGAAGGTACAGAGGCAAGGAGG + Exonic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902373969 1:16021626-16021648 GAAAAAGCACAGAGGGAGAGGGG - Intronic
903062495 1:20679513-20679535 GAGAAGGCAGAGAGGCAGGCAGG + Intronic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
904562687 1:31409359-31409381 GATCATGTGCAGAGCCAGGGTGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
905870993 1:41404589-41404611 GCCAAGGCACGGAGGCAGGGAGG - Intergenic
905936661 1:41829405-41829427 GATAAGCAACAGAGGTAGGGTGG - Intronic
906162483 1:43660708-43660730 GATAATGAAATGAGGCAGTGTGG + Intronic
906282697 1:44565280-44565302 GAAAATGCAGGGAGGGAGGGAGG + Intronic
906708961 1:47915197-47915219 CATCATGCACAAAAGCAGGGAGG + Intronic
907777432 1:57531658-57531680 AATAAAGCAGAGAGGGAGGGAGG + Intronic
908092209 1:60698234-60698256 AATAACCCACAGAGGCATGGAGG + Intergenic
908449702 1:64240171-64240193 GATAGTCCACAGAGCAAGGGAGG + Intronic
913606099 1:120467554-120467576 AATAATAGACACAGGCAGGGAGG - Intergenic
913644286 1:120841926-120841948 AATAATAGACACAGGCAGGGAGG - Intergenic
914082457 1:144421658-144421680 AATAATAGACACAGGCAGGGAGG + Exonic
914177356 1:145290168-145290190 AATAATAGACACAGGCAGGGAGG + Exonic
914210330 1:145572612-145572634 AATAATAGACACAGGCAGGGAGG + Intergenic
914269254 1:146064963-146064985 AATAATAGACACAGGCAGGGAGG + Exonic
914367843 1:146995908-146995930 AATAATAGACACAGGCAGGGAGG - Exonic
914485136 1:148102314-148102336 AATAATAGACACAGGCAGGGAGG + Exonic
914532087 1:148531650-148531672 AATAATAGACACAGGCAGGGAGG + Exonic
914585100 1:149054301-149054323 AATAATAGACACAGGCAGGGAGG + Exonic
914636311 1:149556071-149556093 AATAATAGACACAGGCAGGGAGG - Intergenic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
916255289 1:162781001-162781023 GATAATGGACATAGGAAAGGAGG + Exonic
917475016 1:175362009-175362031 CATAATGACCAGAGGAAGGGAGG - Intronic
917609087 1:176667996-176668018 GAGAATGCACTAAGGCTGGGAGG + Intronic
918809769 1:189100985-189101007 GATTAGGCAGAGAGGGAGGGAGG + Intergenic
919589119 1:199477541-199477563 GTTAAGGCACTGTGGCAGGGAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920041390 1:203100010-203100032 GGGAATGCAGACAGGCAGGGTGG - Intronic
920077570 1:203348318-203348340 GAGACTCCACAGAGGCAGTGAGG + Intronic
920378248 1:205520964-205520986 GACATTGCACAGAGCCACGGAGG + Intronic
920600540 1:207320466-207320488 GAGAATACACAGACACAGGGAGG + Intergenic
920819257 1:209365071-209365093 GATAATGCACAAAGGCCTGGTGG + Intergenic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
922248531 1:223824804-223824826 GATAGAGCACAGAGTGAGGGGGG - Intronic
922685705 1:227637447-227637469 GCCAATGCTCAGAGGCAGGCAGG + Intronic
922710755 1:227829066-227829088 GAGAATGAAGAAAGGCAGGGTGG - Intronic
923954709 1:239002957-239002979 GATAATACACATAGGCAGCCAGG + Intergenic
1064222576 10:13454671-13454693 AATAATGCAAATAGGCTGGGTGG - Intronic
1064600328 10:16986260-16986282 GGAAAGGCACAGAGGGAGGGTGG - Intronic
1066052056 10:31645021-31645043 GAGAATGCCCAGAGGAAAGGAGG + Intergenic
1067191359 10:44070801-44070823 GATGCTGCACAGACACAGGGAGG + Intergenic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1067461982 10:46465085-46465107 GCAAAGGCACAGAGGCAGGAAGG + Intronic
1067625213 10:47919513-47919535 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1069032924 10:63617123-63617145 CAGCATGCACAGAGGCAGTGAGG - Intronic
1069585282 10:69596218-69596240 GATAATGTATAGAGGAATGGTGG + Intergenic
1073446273 10:103582383-103582405 GATGGTGCATAGAGGCTGGGGGG - Intronic
1074586180 10:114769013-114769035 GAGAGTGCACAGAGGAAGAGAGG - Intergenic
1075224520 10:120614658-120614680 GGTATTTCACAGAGGCAGTGTGG - Intergenic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076419888 10:130323917-130323939 GATCATCCACAGAGGAAGGGTGG - Intergenic
1079131667 11:17750301-17750323 GCTGAGCCACAGAGGCAGGGAGG + Intronic
1080181368 11:29430437-29430459 AATAATGCACAATGGCAAGGAGG - Intergenic
1080309612 11:30874488-30874510 GAAAAGGCCAAGAGGCAGGGAGG + Intronic
1080864354 11:36180132-36180154 GATAGTGTACCGAGGCAGGTAGG - Intronic
1082718965 11:56649854-56649876 GAGAATGCACAGACACAGGGAGG + Intergenic
1084657919 11:70529729-70529751 GCAAATCCACAGAGACAGGGAGG - Intronic
1085021917 11:73215448-73215470 GGTGAGGCAGAGAGGCAGGGAGG + Intergenic
1085077721 11:73606597-73606619 CAAAGTGCACAGAGACAGGGAGG + Intergenic
1085670342 11:78458476-78458498 TATAATACACAGAGGTGGGGTGG + Intronic
1087341627 11:96914436-96914458 AATAAGTCACAGAGGGAGGGAGG - Intergenic
1089632155 11:119790532-119790554 GCCCAGGCACAGAGGCAGGGAGG + Intergenic
1091218680 11:133918486-133918508 CACAAAGCACAGAGACAGGGCGG + Intronic
1091234220 11:134009007-134009029 GGTAGTGATCAGAGGCAGGGAGG - Intergenic
1092230881 12:6774668-6774690 ACCAATGCACAGAGGCTGGGCGG - Exonic
1094292437 12:28867048-28867070 GATGGTGCAGAGAAGCAGGGTGG - Intergenic
1094579520 12:31721413-31721435 GGGAATGCAGAGTGGCAGGGAGG - Intronic
1095486447 12:42689701-42689723 GAGGATGCACAGAGGCCAGGAGG + Intergenic
1096444196 12:51674111-51674133 GATAAAGCCTAGAGGCAGGTTGG + Intronic
1096588991 12:52644731-52644753 GGCAATGCAAAGAGGCATGGTGG + Exonic
1097172454 12:57124730-57124752 GAGAAGGCACTGAGGCAGAGAGG + Intronic
1098602024 12:72343256-72343278 GAGTATGCACAGGGGCGGGGTGG - Intronic
1099091011 12:78308118-78308140 AATCATGCCCAGAGGCAGGCTGG - Intergenic
1100566290 12:95797265-95797287 GATAATGGACAGGGGTTGGGAGG + Intergenic
1101360110 12:104018441-104018463 GATAATCCATTAAGGCAGGGAGG - Intronic
1102189567 12:110976777-110976799 GCAAAGGCTCAGAGGCAGGGTGG + Intergenic
1102200163 12:111052326-111052348 GACAATCCACAGAGGGAGGCCGG - Intronic
1102468303 12:113143303-113143325 GAGCATGCACAGGGGCAGGGAGG - Intergenic
1103403814 12:120660840-120660862 GGTAACGGACAGAGGCAGGCAGG + Exonic
1104637353 12:130446670-130446692 GCCAAGGCCCAGAGGCAGGGAGG + Intronic
1104637956 12:130449755-130449777 GAGAACGCACAAAGACAGGGAGG + Intronic
1106577560 13:30989809-30989831 GATAATACACGGATGCAGGGAGG - Intergenic
1107821465 13:44289432-44289454 GAGAATGCACAGAGACACAGAGG - Intergenic
1108453288 13:50588195-50588217 GATGTTGGACAGAGCCAGGGAGG + Intronic
1109083848 13:57944174-57944196 GATAATGGGTAGAGGCAGGAGGG + Intergenic
1109302075 13:60600005-60600027 GAAAAGGCACAGAGGGTGGGTGG + Intergenic
1110869587 13:80434810-80434832 GAGAATGCATAGACACAGGGAGG - Intergenic
1112341117 13:98553600-98553622 GATGCTGCACAGAGACTGGGAGG + Intronic
1113091214 13:106618906-106618928 GATAATGGACTGAGGTAGGGGGG - Intergenic
1114550240 14:23528587-23528609 GATGGTTCACAGAGGCAGAGTGG - Intronic
1116859055 14:49979152-49979174 GAGAATGCACAAGGGCAGGGAGG - Intergenic
1118329019 14:64801476-64801498 GACATTGTACAGAGGCAGGGAGG + Intronic
1118435698 14:65769297-65769319 GAGAAAGCAGCGAGGCAGGGAGG - Intergenic
1118604069 14:67490312-67490334 GAGAATGAAGAGAGGCAGAGTGG + Intronic
1119881407 14:78102897-78102919 GATTTTGGGCAGAGGCAGGGTGG - Intergenic
1120459769 14:84780150-84780172 CATAATGGACAGTGGCAGGAGGG - Intergenic
1122187418 14:100010926-100010948 GAGAATGCAGAGAGGCACTGAGG + Intronic
1122757978 14:103997638-103997660 GGGAGTGCACAGAGGGAGGGTGG + Intronic
1128747408 15:70124220-70124242 GATCATCCTGAGAGGCAGGGAGG - Intergenic
1131635944 15:94232955-94232977 GATAAGGAACTGAGGCAGAGAGG + Intronic
1134053346 16:11153003-11153025 GACAATGCTCAGAGGCTGCGGGG - Intronic
1134183041 16:12062820-12062842 GCTGAAGCACAGAGGCAGGGCGG + Intronic
1134255053 16:12603583-12603605 GAGAAGGCACTGAGGCAGGAAGG + Intergenic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1135953356 16:26935771-26935793 AAAAAAGCTCAGAGGCAGGGAGG + Intergenic
1139048569 16:63094929-63094951 GATAATACACAGGGGCAGTTAGG - Intergenic
1140468815 16:75203611-75203633 GAAAATGCAGAGAGGGAGGCGGG + Intergenic
1142103270 16:88286805-88286827 TATAAGACACAGAGGCAGAGAGG - Intergenic
1142124346 16:88402730-88402752 AATAATGTCCAGAGGCAGGCGGG - Intergenic
1142645196 17:1307174-1307196 CATCATGCACAGGGTCAGGGAGG + Intergenic
1143590321 17:7882232-7882254 GAGAGGGCACAGAGGCAGAGAGG + Intronic
1145278959 17:21454757-21454779 GGTGATGAACAGAAGCAGGGAGG - Intergenic
1146605721 17:34255984-34256006 GATAATGGACAGAGAGAAGGAGG - Intronic
1147338924 17:39742495-39742517 GATAATACACAGAGGCTTGCAGG + Intronic
1149334333 17:55620032-55620054 CATAATCCAGAGAGGCAGTGTGG - Intergenic
1150387349 17:64772801-64772823 GAGAAGGCAAGGAGGCAGGGTGG + Intergenic
1151694513 17:75707337-75707359 GATAACACACAGAGGAAGGGTGG - Exonic
1152018893 17:77770326-77770348 GAGAAGGGACAGAGGGAGGGAGG - Intergenic
1152181365 17:78823690-78823712 GAGAAGGCAAAGAGGCAGGCAGG + Intronic
1152214916 17:79026553-79026575 GAGAATGCCCAGGGGCAGGAAGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152380046 17:79937593-79937615 GATCAAGTACAGAGGGAGGGAGG - Exonic
1153504235 18:5779776-5779798 GATAATGCAAGGAGGCAGAATGG + Intergenic
1153684347 18:7529977-7529999 GATGATGAACAAAGGCAGAGAGG - Intergenic
1153717993 18:7870018-7870040 GAAATTGCACAGTGGCATGGTGG + Intronic
1158958535 18:62566483-62566505 GAGAAGGAACAGAGACAGGGAGG - Intronic
1159355676 18:67335411-67335433 GCCACTGCCCAGAGGCAGGGAGG - Intergenic
1159599052 18:70411322-70411344 GAGCTTGCACAGAGGGAGGGTGG - Intergenic
1160132144 18:76235012-76235034 GACCATTCACAGAGGAAGGGGGG - Intergenic
1160719776 19:592031-592053 GGTGGGGCACAGAGGCAGGGTGG - Intronic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1161140503 19:2644662-2644684 GCCGATCCACAGAGGCAGGGAGG - Intronic
1161286414 19:3470834-3470856 GGCAATGAACAGAGGAAGGGCGG + Intergenic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161355621 19:3817964-3817986 GCCAATCCACAGAGACAGGGCGG + Intronic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161649313 19:5474619-5474641 GATACTTGAAAGAGGCAGGGAGG + Intergenic
1161805304 19:6440106-6440128 AATAACACACACAGGCAGGGAGG + Exonic
1162782075 19:13011700-13011722 CCTAATGCACAGAGGCACTGGGG - Intronic
1163012722 19:14435221-14435243 TGTAATGCACAGAGGGAGGGAGG - Intronic
1163160254 19:15460034-15460056 GATCTAGCACAGAGCCAGGGTGG - Intronic
1163270513 19:16250479-16250501 GATACTGCCCTGAGGCTGGGCGG - Intergenic
1164411818 19:28012551-28012573 TACAATGCACAGAGGGAGCGGGG - Intergenic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1166536547 19:43578290-43578312 GAGAAAGCTCAGGGGCAGGGAGG - Intronic
1166691809 19:44826201-44826223 GAGAAGGAAGAGAGGCAGGGAGG + Intergenic
1166777561 19:45322189-45322211 GAGAGGGCACTGAGGCAGGGTGG + Intronic
925616933 2:5752566-5752588 GCTGCTGCACAGAGGAAGGGCGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925749689 2:7076686-7076708 GTTCATGCAGGGAGGCAGGGGGG + Intergenic
926244664 2:11113795-11113817 GAGAAAGGACAGAGGGAGGGAGG - Intergenic
928245276 2:29621412-29621434 GACAATGGCCAGAGGCTGGGAGG - Intronic
928393001 2:30923598-30923620 GATGCTGCCCAGAGACAGGGTGG + Intronic
928644625 2:33339033-33339055 GAGAATGGATAGAGGGAGGGAGG + Intronic
929442060 2:41972407-41972429 GATAAAGCACTGGGGCAGGGAGG + Intergenic
930152855 2:48076248-48076270 GAGAAAGCACAGAGCCAGTGAGG + Intergenic
930153205 2:48078867-48078889 GAAAAGGCACAGAGACAGGCCGG - Intergenic
931904411 2:66826807-66826829 GATAATGCACAGAAACAGCATGG + Intergenic
934913229 2:98277703-98277725 GAAAATGCACACAGGGAGGCAGG + Intronic
935418368 2:102842243-102842265 AATAATGCAGAGAGGGAGGTAGG - Intronic
935796011 2:106642212-106642234 GATAATCCACAGGGGAAGTGCGG + Intergenic
936929267 2:117770297-117770319 TATAATACACAGATGCAGGCAGG + Intergenic
940044938 2:149400004-149400026 GACAACCCACAGATGCAGGGTGG + Intronic
943771957 2:191727651-191727673 GAAAAACCACAGAGGCAGGAAGG + Intergenic
943785645 2:191875578-191875600 GTTGAAGCAGAGAGGCAGGGTGG + Intergenic
944663357 2:201939461-201939483 GATGATGCACAGAGTCGGGCAGG - Intergenic
946640164 2:221775370-221775392 GAGAATGCAGAGAGGGAGAGAGG - Intergenic
947906248 2:233765557-233765579 GAGAATGCGTAGACGCAGGGAGG + Intronic
948547310 2:238742082-238742104 GAAAAAGAACAGAGGCAGGGTGG + Intergenic
948855261 2:240727356-240727378 GAGGAAGGACAGAGGCAGGGAGG + Intronic
949018629 2:241727919-241727941 GATGGTGCACAGTGGCAGGCAGG - Exonic
1169639307 20:7732199-7732221 GATAAGACACAGAGGGAGCGAGG + Intergenic
1170141617 20:13130618-13130640 GTTAATGCACACAGGCTGAGGGG + Intronic
1174090092 20:48039783-48039805 GAGAAGCCAGAGAGGCAGGGAGG + Intergenic
1175700897 20:61136342-61136364 GTTCATTCACAGAGGCAGGGAGG + Intergenic
1178795938 21:35744390-35744412 GATAAAGCAGGGAGGAAGGGAGG - Intronic
1178925273 21:36769531-36769553 GAAAATATACAGAAGCAGGGAGG - Intronic
1179237915 21:39563621-39563643 GATAAGGGAGAGAGGGAGGGAGG - Intronic
1179436833 21:41368190-41368212 GGCTATGCACAGAGGCAGGAGGG - Intronic
1179476352 21:41648668-41648690 GATAAGGCACAGCAGCAGGGTGG + Intergenic
1181727466 22:24821408-24821430 GCAAAAGCACTGAGGCAGGGAGG + Intronic
1182168638 22:28203708-28203730 GTTAATCCACAGAGGCAGGTGGG - Intronic
1183508851 22:38223506-38223528 GGGAAGGCACAGAGGAAGGGGGG + Intronic
1183866507 22:40708472-40708494 GATCATCCAGAGAGGCAGGAGGG + Intergenic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
1184293244 22:43509158-43509180 GATGATGGACGGAGGGAGGGAGG - Intergenic
1185135395 22:49068737-49068759 GGGAATTCACAGAGGCAGGACGG - Intergenic
949358930 3:3211314-3211336 GACAATGCACACAGGCAGAAAGG + Intergenic
950217236 3:11168381-11168403 GATGACGCACAGAGGAAGCGGGG + Intronic
950618071 3:14178395-14178417 GAGGAGGCCCAGAGGCAGGGCGG - Exonic
952932144 3:38368664-38368686 GACACTGCAGAGAGGGAGGGAGG + Intronic
954452168 3:50577560-50577582 GAGAATGCTCAGAGGTAGGTGGG + Exonic
955910287 3:63852763-63852785 GGAAAAGCCCAGAGGCAGGGAGG + Intronic
956081109 3:65557243-65557265 GAGAATGCACAGAACCAAGGTGG - Intronic
956168824 3:66416881-66416903 GACAAGGGACAGAGGCAGGAAGG - Intronic
958640799 3:96801519-96801541 GAGAATGCAGAAAAGCAGGGTGG - Intergenic
960158067 3:114318213-114318235 GATAATCCACAGAGTCAAAGAGG + Intergenic
960195268 3:114759243-114759265 AATAATGCAGTGAGGCTGGGAGG + Intronic
960497545 3:118394240-118394262 AATAACACACACAGGCAGGGAGG + Intergenic
960544549 3:118898614-118898636 GATGATGATCAGAGGAAGGGTGG + Intergenic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
960886860 3:122404921-122404943 GATAATGCTTTGTGGCAGGGGGG + Intronic
961239255 3:125396174-125396196 GATAATGCACACAGGAAACGTGG - Intergenic
961333504 3:126156632-126156654 GGTACTGCTGAGAGGCAGGGTGG - Intronic
961646991 3:128397977-128397999 GTCAGTGCACAGAGGCTGGGGGG - Intronic
962938986 3:140108448-140108470 GGGAATGGAAAGAGGCAGGGAGG - Intronic
966983504 3:185159132-185159154 GAGAAGGCACTGAGGCAGGCAGG - Intergenic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
971228655 4:24779255-24779277 GATAATGCAAAGAGGCATTTTGG - Intergenic
971421101 4:26474878-26474900 GACAATGAACAGTGGCAGGAGGG - Intergenic
973041559 4:45475783-45475805 GCTCAGGCACAGAGGGAGGGGGG + Intergenic
976378080 4:84367458-84367480 AATAATGCCCAGAGACAGCGGGG - Intergenic
976512088 4:85922945-85922967 GATTTTGCACAGAGGCACTGCGG + Intronic
977487225 4:97664931-97664953 GCCACTGCACACAGGCAGGGAGG + Intronic
978577238 4:110199248-110199270 ATTAATGAACAGAGGCAGAGTGG + Intergenic
985485296 5:145327-145349 GACAAAGGACAGAGGCAGGAAGG + Intronic
986493404 5:8317122-8317144 GGTAATGCAGACTGGCAGGGAGG + Intergenic
986873637 5:12080309-12080331 GATAGTGCACAGAGCCTGGGAGG + Intergenic
988283072 5:29174655-29174677 GATAGAGCACAGAGACAGTGAGG + Intergenic
988514906 5:31895839-31895861 AAGAAAGGACAGAGGCAGGGTGG - Intronic
990674247 5:58165731-58165753 TTGAATGCACAGAGGCAGTGGGG + Intergenic
990826377 5:59903803-59903825 GACACTGCAGAGAGGCAGGCAGG - Intronic
991166277 5:63567684-63567706 GCAACTGCTCAGAGGCAGGGTGG - Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
992179665 5:74183888-74183910 GAAACTGCACAGAGGCAAGAGGG + Intergenic
992184000 5:74225932-74225954 AAGAAGGCACAGAGGAAGGGAGG - Intergenic
993349871 5:86836495-86836517 GACACTACACATAGGCAGGGTGG - Intergenic
996115928 5:119618439-119618461 GATAATTACCAGAGGCTGGGAGG - Intronic
996192901 5:120567367-120567389 GGTAAAGCACAGTGGCAGGAGGG - Intronic
996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG + Intergenic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
999119353 5:149197289-149197311 GCCAAAGCACAGAGGCAGGAAGG - Intronic
999482672 5:151963167-151963189 GAGAATGCAATGAGGCAGGGTGG - Intergenic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
1000122286 5:158208791-158208813 GAGAATGTACAAAGGCAGTGAGG + Intergenic
1000195315 5:158951518-158951540 GATAATGCACAGATTCAATGGGG + Intronic
1000209802 5:159098595-159098617 GAAAATGGAGAGAGGAAGGGAGG + Intronic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1000732460 5:164853270-164853292 TATCATGAACAGAGGCATGGAGG + Intergenic
1001419739 5:171577585-171577607 GATGATGCAGAGAGGCAGCCTGG + Intergenic
1001787993 5:174430469-174430491 GCTAATGCACAAAGGCAGAGTGG + Intergenic
1004889232 6:20082749-20082771 GATAATTCAAAGAGACAGGAAGG - Intergenic
1005352934 6:24954187-24954209 GAGGATGCTCAGAGGCAGGCTGG + Intronic
1005897274 6:30189010-30189032 GAAAGTGCAAAGAGGGAGGGGGG + Intronic
1006365032 6:33610269-33610291 GAAAAGGCCCAGAGGCAGGAAGG - Intergenic
1006623131 6:35381094-35381116 GATGAGGGACAGAGGCAGGAGGG - Intronic
1007726740 6:43921347-43921369 GAGAAGGCACAGAGGCGGGCAGG + Intergenic
1008731201 6:54484711-54484733 GAAAATGCACAGGAGCTGGGAGG - Intergenic
1008910111 6:56722789-56722811 GAACATGTACAAAGGCAGGGAGG + Intronic
1009449659 6:63786485-63786507 GAAAATGCACGGACACAGGGAGG + Intronic
1010805690 6:80233586-80233608 AATAATCCCCAGAGCCAGGGAGG - Intronic
1011146204 6:84220022-84220044 GATAATGCACAGAGGCAGGGAGG + Intronic
1011243060 6:85293222-85293244 GAGAATACACAGACACAGGGAGG + Intergenic
1012572258 6:100743225-100743247 GATAATGAAGAAAAGCAGGGTGG - Intronic
1014056734 6:117024726-117024748 CATCATGCACAGAGGCACTGGGG + Intergenic
1014959171 6:127660892-127660914 GAGAATGCACGGACACAGGGCGG + Intergenic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1018816907 6:167339977-167339999 GAGACTGCACAGTGGGAGGGTGG + Intronic
1018977433 6:168575976-168575998 CATGAGACACAGAGGCAGGGTGG + Intronic
1020699395 7:11460271-11460293 TATAATGCATATAGGCAAGGAGG + Intronic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1022842847 7:34181171-34181193 GATAATAGGCAGAGGCAGGAAGG + Intergenic
1023940754 7:44767207-44767229 GCTGATGCACAGAGGGAGTGTGG + Intronic
1025107391 7:56183239-56183261 GATAATTCACATAGGCTAGGTGG + Intergenic
1026217268 7:68360723-68360745 GCAAATGCACACAGGTAGGGAGG - Intergenic
1026491874 7:70870515-70870537 GAGAATGCACGGACACAGGGAGG - Intergenic
1027126388 7:75559639-75559661 GATGCGGCACAGAGGCTGGGTGG - Intronic
1028145145 7:87312910-87312932 AATAGTGCACAGAGGTAGGCAGG + Intergenic
1028481379 7:91309625-91309647 GAAAAAACACAGAGGCCGGGAGG - Intergenic
1029448779 7:100629169-100629191 GATAGGGCAGAGAGGCAGTGAGG - Intronic
1032310751 7:130784561-130784583 GTGACTGCAAAGAGGCAGGGGGG - Intergenic
1032731309 7:134646158-134646180 CTTATTGCACAGAGGAAGGGAGG - Intergenic
1033283946 7:140025008-140025030 GACATGGCACAGAGGGAGGGAGG - Intronic
1033977298 7:147117205-147117227 AATCATGCACAGAGACAGGGTGG - Intronic
1034294623 7:149961221-149961243 GGAATTGCACAGAGGAAGGGGGG + Intergenic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1034811435 7:154135650-154135672 GGAATTGCACAGAGGAAGGGGGG - Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1039969307 8:42307906-42307928 GCAAAAGCACAGAGACAGGGTGG - Intronic
1042943523 8:74131714-74131736 GACAATGCCCAAAGGCAGGAAGG + Intergenic
1044594287 8:93942952-93942974 TATTTTGCACAGAGGCACGGAGG - Intergenic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1046707079 8:117466833-117466855 GAGAAAGCACAGAGGCAGTTGGG - Intergenic
1047209823 8:122832359-122832381 GCCAATGCTCAGAGGCAGGCAGG + Intronic
1047510123 8:125509517-125509539 GAAATTCCAAAGAGGCAGGGTGG - Intergenic
1048578747 8:135713507-135713529 GGTAAAGCACAGAGGGAAGGAGG + Intergenic
1049526803 8:143130972-143130994 GATCAAGCTCTGAGGCAGGGAGG - Intergenic
1052575211 9:30282402-30282424 GCAAATGCCCAGAAGCAGGGTGG + Intergenic
1052842638 9:33306080-33306102 AAAAAAGCACAGAGGCAGGGAGG + Intronic
1052866887 9:33469424-33469446 GAGAAGGCACAGAGGCACGGAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054853296 9:69871236-69871258 AATAATAAACAAAGGCAGGGAGG + Intronic
1055286716 9:74736355-74736377 GATAATGCACATTGTCTGGGTGG - Intronic
1055513976 9:77019254-77019276 GAAAAAGCAAAGAGGCCGGGAGG + Intergenic
1055567582 9:77584582-77584604 GATGATGCCAAGGGGCAGGGAGG + Intronic
1055583336 9:77731215-77731237 GACTATGCGCAGAGACAGGGAGG + Intronic
1056084909 9:83137820-83137842 GTAAATGCTCAGAGGCAGGAGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056604486 9:88075567-88075589 GATAAGATACAGAGGCAGGGGGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058637758 9:107053125-107053147 AATGATGCACTAAGGCAGGGAGG + Intergenic
1058640396 9:107078320-107078342 GCTAGTGCAGAGAGGCAGGATGG + Intergenic
1059519743 9:114930151-114930173 GACAAGGCACAGAGCCAGAGTGG + Exonic
1059521145 9:114943457-114943479 ACTAATGCAAAGAGGCAGAGTGG - Intergenic
1059887978 9:118768249-118768271 GCAAAGGCACAGAGGCAGGAAGG - Intergenic
1061553480 9:131351170-131351192 GATAATGAACAGTGGCTGGCCGG + Intergenic
1061952566 9:133944500-133944522 GACAATGACCACAGGCAGGGAGG + Intronic
1062180430 9:135188509-135188531 GTCAAGGCACAGGGGCAGGGCGG - Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1186160205 X:6769432-6769454 ATTAATCCACAGAGGCAGGTGGG + Intergenic
1188880538 X:35486701-35486723 GAGAGTGCACTGCGGCAGGGTGG + Intergenic
1192314598 X:70042092-70042114 GACTCTGCTCAGAGGCAGGGAGG - Intronic
1192726874 X:73763344-73763366 GAGAATGCAAAGACACAGGGAGG - Intergenic
1193338409 X:80317929-80317951 GCTAAGGCACAGAGGGAGGTGGG + Intergenic
1195704383 X:107728539-107728561 GATAAAGCCCAGGAGCAGGGTGG + Intronic
1199401537 X:147405126-147405148 GATAACGAACAGAAGCAGGGTGG + Intergenic
1199467446 X:148154962-148154984 GATAAGGCAGAGAGGTAGGCAGG - Intergenic