ID: 1011149746

View in Genome Browser
Species Human (GRCh38)
Location 6:84257867-84257889
Sequence GGTTCTGTTGGAGCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011149741_1011149746 20 Left 1011149741 6:84257824-84257846 CCATAGCAGGGCCTCTGAATCTG No data
Right 1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG No data
1011149740_1011149746 24 Left 1011149740 6:84257820-84257842 CCAACCATAGCAGGGCCTCTGAA No data
Right 1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG No data
1011149742_1011149746 9 Left 1011149742 6:84257835-84257857 CCTCTGAATCTGATTAGATAAAA No data
Right 1011149746 6:84257867-84257889 GGTTCTGTTGGAGCAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011149746 Original CRISPR GGTTCTGTTGGAGCAGAGGC AGG Intergenic
No off target data available for this crispr