ID: 1011151488

View in Genome Browser
Species Human (GRCh38)
Location 6:84278519-84278541
Sequence CTGTGGAAATGTACTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011151488_1011151492 -6 Left 1011151488 6:84278519-84278541 CCCTGTGAAGTACATTTCCACAG No data
Right 1011151492 6:84278536-84278558 CCACAGATCAGGTTTCTGCCAGG No data
1011151488_1011151493 -5 Left 1011151488 6:84278519-84278541 CCCTGTGAAGTACATTTCCACAG No data
Right 1011151493 6:84278537-84278559 CACAGATCAGGTTTCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011151488 Original CRISPR CTGTGGAAATGTACTTCACA GGG (reversed) Intergenic
No off target data available for this crispr