ID: 1011153076

View in Genome Browser
Species Human (GRCh38)
Location 6:84297245-84297267
Sequence TACCACAACCTCCTACCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011153076_1011153078 -10 Left 1011153076 6:84297245-84297267 CCTTCAGGTAGGAGGTTGTGGTA No data
Right 1011153078 6:84297258-84297280 GGTTGTGGTACTGGCCTTGAAGG No data
1011153076_1011153081 23 Left 1011153076 6:84297245-84297267 CCTTCAGGTAGGAGGTTGTGGTA No data
Right 1011153081 6:84297291-84297313 TTTCCCTGTATGAAGCCAGTGGG No data
1011153076_1011153080 22 Left 1011153076 6:84297245-84297267 CCTTCAGGTAGGAGGTTGTGGTA No data
Right 1011153080 6:84297290-84297312 CTTTCCCTGTATGAAGCCAGTGG No data
1011153076_1011153082 24 Left 1011153076 6:84297245-84297267 CCTTCAGGTAGGAGGTTGTGGTA No data
Right 1011153082 6:84297292-84297314 TTCCCTGTATGAAGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011153076 Original CRISPR TACCACAACCTCCTACCTGA AGG (reversed) Intergenic
No off target data available for this crispr