ID: 1011153247

View in Genome Browser
Species Human (GRCh38)
Location 6:84299077-84299099
Sequence GTGCCCATTCAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011153247_1011153251 19 Left 1011153247 6:84299077-84299099 CCTTCACTCTTCTGAATGGGCAC No data
Right 1011153251 6:84299119-84299141 TCCATGGATTGGAGTAAATGAGG No data
1011153247_1011153253 29 Left 1011153247 6:84299077-84299099 CCTTCACTCTTCTGAATGGGCAC No data
Right 1011153253 6:84299129-84299151 GGAGTAAATGAGGCAATGATTGG No data
1011153247_1011153250 8 Left 1011153247 6:84299077-84299099 CCTTCACTCTTCTGAATGGGCAC No data
Right 1011153250 6:84299108-84299130 AGGTCTCTTTATCCATGGATTGG No data
1011153247_1011153249 3 Left 1011153247 6:84299077-84299099 CCTTCACTCTTCTGAATGGGCAC No data
Right 1011153249 6:84299103-84299125 TTGTTAGGTCTCTTTATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011153247 Original CRISPR GTGCCCATTCAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr