ID: 1011160948

View in Genome Browser
Species Human (GRCh38)
Location 6:84389877-84389899
Sequence AAGCACTCCCCAATATCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011160944_1011160948 16 Left 1011160944 6:84389838-84389860 CCCTCCTTTGGGTTAGTGCCTGA No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data
1011160947_1011160948 -2 Left 1011160947 6:84389856-84389878 CCTGAGCATGTTATTAGACACAA No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data
1011160946_1011160948 12 Left 1011160946 6:84389842-84389864 CCTTTGGGTTAGTGCCTGAGCAT No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data
1011160941_1011160948 27 Left 1011160941 6:84389827-84389849 CCTCCAGTCAGCCCTCCTTTGGG No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data
1011160945_1011160948 15 Left 1011160945 6:84389839-84389861 CCTCCTTTGGGTTAGTGCCTGAG No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data
1011160943_1011160948 24 Left 1011160943 6:84389830-84389852 CCAGTCAGCCCTCCTTTGGGTTA No data
Right 1011160948 6:84389877-84389899 AAGCACTCCCCAATATCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011160948 Original CRISPR AAGCACTCCCCAATATCCCA AGG Intergenic
No off target data available for this crispr