ID: 1011161332

View in Genome Browser
Species Human (GRCh38)
Location 6:84393569-84393591
Sequence AACCCACAGCAGCCAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011161327_1011161332 15 Left 1011161327 6:84393531-84393553 CCTGGAGAAGAGGGCAACTGTGT No data
Right 1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG No data
1011161328_1011161332 -9 Left 1011161328 6:84393555-84393577 CCTTTTGCAGCCAAAACCCACAG No data
Right 1011161332 6:84393569-84393591 AACCCACAGCAGCCAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011161332 Original CRISPR AACCCACAGCAGCCAGGGCA TGG Intergenic
No off target data available for this crispr