ID: 1011162988

View in Genome Browser
Species Human (GRCh38)
Location 6:84413132-84413154
Sequence ATCCAACAGGACTGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011162988_1011162992 3 Left 1011162988 6:84413132-84413154 CCCTGGATCCAGTCCTGTTGGAT No data
Right 1011162992 6:84413158-84413180 TAATTCTGAGAATGCAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011162988 Original CRISPR ATCCAACAGGACTGGATCCA GGG (reversed) Intergenic
No off target data available for this crispr