ID: 1011163766

View in Genome Browser
Species Human (GRCh38)
Location 6:84422409-84422431
Sequence CTCAACCACTGGTGCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011163764_1011163766 -6 Left 1011163764 6:84422392-84422414 CCTAAATTCAGCAATTACTCAAC No data
Right 1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011163766 Original CRISPR CTCAACCACTGGTGCAGAGA AGG Intergenic
No off target data available for this crispr