ID: 1011167575

View in Genome Browser
Species Human (GRCh38)
Location 6:84466652-84466674
Sequence TAGCTCAGGCAGCCACATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011167575_1011167578 -7 Left 1011167575 6:84466652-84466674 CCTGAATGTGGCTGCCTGAGCTA No data
Right 1011167578 6:84466668-84466690 TGAGCTAAGCCCGGTCCTGCTGG No data
1011167575_1011167579 -6 Left 1011167575 6:84466652-84466674 CCTGAATGTGGCTGCCTGAGCTA No data
Right 1011167579 6:84466669-84466691 GAGCTAAGCCCGGTCCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011167575 Original CRISPR TAGCTCAGGCAGCCACATTC AGG (reversed) Intergenic
No off target data available for this crispr