ID: 1011168701

View in Genome Browser
Species Human (GRCh38)
Location 6:84479900-84479922
Sequence CTATGGATGTGGCTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011168701_1011168713 18 Left 1011168701 6:84479900-84479922 CCCACAGGAAGCCACATCCATAG No data
Right 1011168713 6:84479941-84479963 ACATCAAGGGAACATCCTGTGGG No data
1011168701_1011168711 5 Left 1011168701 6:84479900-84479922 CCCACAGGAAGCCACATCCATAG No data
Right 1011168711 6:84479928-84479950 GGGGGAGAGAACTACATCAAGGG No data
1011168701_1011168710 4 Left 1011168701 6:84479900-84479922 CCCACAGGAAGCCACATCCATAG No data
Right 1011168710 6:84479927-84479949 AGGGGGAGAGAACTACATCAAGG No data
1011168701_1011168712 17 Left 1011168701 6:84479900-84479922 CCCACAGGAAGCCACATCCATAG No data
Right 1011168712 6:84479940-84479962 TACATCAAGGGAACATCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011168701 Original CRISPR CTATGGATGTGGCTTCCTGT GGG (reversed) Intergenic