ID: 1011177537

View in Genome Browser
Species Human (GRCh38)
Location 6:84581259-84581281
Sequence GGTCATCATACAACTCCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011177537_1011177540 14 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177540 6:84581296-84581318 ATTCTTGATGGTGACACTGATGG No data
1011177537_1011177539 2 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177539 6:84581284-84581306 AAATGCTACTAGATTCTTGATGG No data
1011177537_1011177541 15 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177541 6:84581297-84581319 TTCTTGATGGTGACACTGATGGG No data
1011177537_1011177542 26 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011177537 Original CRISPR GGTCATCATACAACTCCAAC TGG (reversed) Intergenic
No off target data available for this crispr