ID: 1011177538

View in Genome Browser
Species Human (GRCh38)
Location 6:84581280-84581302
Sequence CAAGAATCTAGTAGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011177538_1011177540 -7 Left 1011177538 6:84581280-84581302 CCAGAAATGCTACTAGATTCTTG No data
Right 1011177540 6:84581296-84581318 ATTCTTGATGGTGACACTGATGG No data
1011177538_1011177542 5 Left 1011177538 6:84581280-84581302 CCAGAAATGCTACTAGATTCTTG No data
Right 1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG No data
1011177538_1011177541 -6 Left 1011177538 6:84581280-84581302 CCAGAAATGCTACTAGATTCTTG No data
Right 1011177541 6:84581297-84581319 TTCTTGATGGTGACACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011177538 Original CRISPR CAAGAATCTAGTAGCATTTC TGG (reversed) Intergenic
No off target data available for this crispr