ID: 1011177539

View in Genome Browser
Species Human (GRCh38)
Location 6:84581284-84581306
Sequence AAATGCTACTAGATTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011177536_1011177539 11 Left 1011177536 6:84581250-84581272 CCTTCTTATCCAGTTGGAGTTGT No data
Right 1011177539 6:84581284-84581306 AAATGCTACTAGATTCTTGATGG No data
1011177537_1011177539 2 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177539 6:84581284-84581306 AAATGCTACTAGATTCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011177539 Original CRISPR AAATGCTACTAGATTCTTGA TGG Intergenic
No off target data available for this crispr