ID: 1011177541

View in Genome Browser
Species Human (GRCh38)
Location 6:84581297-84581319
Sequence TTCTTGATGGTGACACTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011177536_1011177541 24 Left 1011177536 6:84581250-84581272 CCTTCTTATCCAGTTGGAGTTGT No data
Right 1011177541 6:84581297-84581319 TTCTTGATGGTGACACTGATGGG No data
1011177538_1011177541 -6 Left 1011177538 6:84581280-84581302 CCAGAAATGCTACTAGATTCTTG No data
Right 1011177541 6:84581297-84581319 TTCTTGATGGTGACACTGATGGG No data
1011177537_1011177541 15 Left 1011177537 6:84581259-84581281 CCAGTTGGAGTTGTATGATGACC No data
Right 1011177541 6:84581297-84581319 TTCTTGATGGTGACACTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011177541 Original CRISPR TTCTTGATGGTGACACTGAT GGG Intergenic
No off target data available for this crispr