ID: 1011180636

View in Genome Browser
Species Human (GRCh38)
Location 6:84616115-84616137
Sequence GCATGTGTTACCCACCACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011180633_1011180636 4 Left 1011180633 6:84616088-84616110 CCTAGAAACCTACATATATTTCA No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180632_1011180636 9 Left 1011180632 6:84616083-84616105 CCTCACCTAGAAACCTACATATA No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180628_1011180636 13 Left 1011180628 6:84616079-84616101 CCCCCCTCACCTAGAAACCTACA No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180627_1011180636 26 Left 1011180627 6:84616066-84616088 CCAAAGACAATTTCCCCCCTCAC No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180629_1011180636 12 Left 1011180629 6:84616080-84616102 CCCCCTCACCTAGAAACCTACAT No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180635_1011180636 -4 Left 1011180635 6:84616096-84616118 CCTACATATATTTCAAATGGCAT No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180631_1011180636 10 Left 1011180631 6:84616082-84616104 CCCTCACCTAGAAACCTACATAT No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data
1011180630_1011180636 11 Left 1011180630 6:84616081-84616103 CCCCTCACCTAGAAACCTACATA No data
Right 1011180636 6:84616115-84616137 GCATGTGTTACCCACCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011180636 Original CRISPR GCATGTGTTACCCACCACCG TGG Intergenic
No off target data available for this crispr