ID: 1011181079

View in Genome Browser
Species Human (GRCh38)
Location 6:84621769-84621791
Sequence TTGTATATGATGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011181079_1011181083 -6 Left 1011181079 6:84621769-84621791 CCCTTCTCCCTCATCATATACAA No data
Right 1011181083 6:84621786-84621808 ATACAAAATTTAATTCTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011181079 Original CRISPR TTGTATATGATGAGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr