ID: 1011183987

View in Genome Browser
Species Human (GRCh38)
Location 6:84653774-84653796
Sequence AGGTTTTAACACATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011183976_1011183987 27 Left 1011183976 6:84653724-84653746 CCTAATCACCTCCAAGGGCTCTA No data
Right 1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG No data
1011183980_1011183987 4 Left 1011183980 6:84653747-84653769 CCTTTTAGCACTATCACCTTGGG No data
Right 1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG No data
1011183977_1011183987 19 Left 1011183977 6:84653732-84653754 CCTCCAAGGGCTCTACCTTTTAG No data
Right 1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG No data
1011183978_1011183987 16 Left 1011183978 6:84653735-84653757 CCAAGGGCTCTACCTTTTAGCAC No data
Right 1011183987 6:84653774-84653796 AGGTTTTAACACATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011183987 Original CRISPR AGGTTTTAACACATGGATTT TGG Intergenic
No off target data available for this crispr