ID: 1011186147

View in Genome Browser
Species Human (GRCh38)
Location 6:84677735-84677757
Sequence CTGAGTGAATAGGAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011186147_1011186151 -1 Left 1011186147 6:84677735-84677757 CCACCTTCCTCCTATTCACTCAG No data
Right 1011186151 6:84677757-84677779 GAGTACTTAAACGTCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011186147 Original CRISPR CTGAGTGAATAGGAGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr