ID: 1011189091

View in Genome Browser
Species Human (GRCh38)
Location 6:84712068-84712090
Sequence CGGTGAACAGCAGTGGCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 2, 2: 13, 3: 97, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011189079_1011189091 24 Left 1011189079 6:84712021-84712043 CCCTGCCAGATCCAGAGGGGTGG 0: 10
1: 46
2: 99
3: 132
4: 299
Right 1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG 0: 1
1: 2
2: 13
3: 97
4: 251
1011189081_1011189091 23 Left 1011189081 6:84712022-84712044 CCTGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG 0: 1
1: 2
2: 13
3: 97
4: 251
1011189082_1011189091 19 Left 1011189082 6:84712026-84712048 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG 0: 1
1: 2
2: 13
3: 97
4: 251
1011189084_1011189091 13 Left 1011189084 6:84712032-84712054 CCAGAGGGGTGGAAGTCAATGGC 0: 4
1: 32
2: 85
3: 96
4: 190
Right 1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG 0: 1
1: 2
2: 13
3: 97
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011189091 Original CRISPR CGGTGAACAGCAGTGGCGGA CGG Intronic
901325191 1:8361183-8361205 GGGGGAACTGCAGTGGCAGAGGG + Exonic
906151640 1:43591194-43591216 CGGTGAACAGCATCGGGCGAGGG + Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907516613 1:54997122-54997144 CGGTGATGAGCAGTCGCGGCGGG - Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602971 1:55788566-55788588 CGGTGAACAGCCGTGGTGGACGG + Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909695639 1:78465413-78465435 TGGTGAAGAGCAGTGGGTGAGGG + Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911055345 1:93703781-93703803 AGGTCAACAGAAGTGGCAGAGGG - Intronic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920294904 1:204950141-204950163 CAGTGAACAGGAGAGGCTGAGGG - Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077100245 11:819365-819387 CCGTGCCCAGCAGGGGCGGAGGG + Intronic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081614331 11:44581663-44581685 CGGTGAACTGCAGTGGATGGTGG + Intronic
1082737600 11:56873900-56873922 CGATGATCGGCAGTGGTGGATGG - Intergenic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084916748 11:72434327-72434349 CGGGGAGCCGCAGTGGCTGAGGG - Exonic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1092293641 12:7181266-7181288 TGGTGATCAGCAATGGTGGACGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1096102599 12:48978730-48978752 CTGCCAACAGCAGTGGCCGATGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096933057 12:55237350-55237372 CGATGAATAACAGTGGCGAAAGG - Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098544216 12:71693631-71693653 CTGTGAATAGCAGTAGTGGAAGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101796041 12:107975221-107975243 CAGTGCACAGCAGCAGCGGAGGG + Intergenic
1103802552 12:123548793-123548815 TGGTGATCAGCAGTGGTGGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1106713440 13:32362808-32362830 AGGAGAACAGCAGTGTGGGATGG - Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107299794 13:38953686-38953708 TGATGAAAAGCAGTGGTGGAGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109169801 13:59081374-59081396 GGGTGAACAGCAGAGGCCCAGGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660420 13:78054324-78054346 CAGTGACCAGCAGTGACGGAGGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111686103 13:91502453-91502475 AGGTGAACAGCACTGGAGGGAGG + Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1113799506 13:113079038-113079060 CTGTGAATGGCAGTGGCGGGTGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118990095 14:70790164-70790186 CCCTGAGCAGCAGTGGGGGAAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120723895 14:87916645-87916667 GGGTGAGCTGCAGTGGAGGAAGG + Intronic
1121711157 14:96039829-96039851 AGGGGGACAGCAGTGGGGGATGG - Intronic
1122436471 14:101704515-101704537 CAATGCACAGCAGTGGCAGAGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123509273 15:20979822-20979844 TAGTGAACAGCAGGGGCGGTGGG + Intergenic
1123602758 15:21990855-21990877 TAGTGAACAGCAGGGGCGGTGGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125255620 15:37759651-37759673 CAGGGAACAGCAGTGGATGATGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129291172 15:74569002-74569024 CAGGGAACAGCAGAGGCAGATGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130859992 15:87877304-87877326 CAGTGAGCAGCAGTGGCTGGTGG + Intronic
1131120929 15:89823053-89823075 TGGTGACCAGCAGTGGGGGAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1202974861 15_KI270727v1_random:280657-280679 TAGTGAACAGCAGGGGCGGTGGG + Intergenic
1132541987 16:514429-514451 CTGGGAACAGCAGGGGCGGGTGG + Intronic
1135538580 16:23312882-23312904 TGGTGAAGAGCTGTGGTGGAGGG + Intronic
1136460373 16:30407043-30407065 CGCTGAACAGCGCTGGCGCATGG + Intergenic
1138087200 16:54143879-54143901 AGGTGAACAGCGGTAGGGGAAGG + Intergenic
1139548598 16:67661242-67661264 TGGAGACCAGCAGTGGAGGAAGG - Intronic
1142268736 16:89078086-89078108 CGGTGAACTCCATTGTCGGAGGG + Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142591725 17:1009231-1009253 GGGTGGACAGCAGTGGGGAATGG - Intronic
1142591729 17:1009248-1009270 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1142591735 17:1009265-1009287 GGGTGGACAGCAGTGGGGGGTGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148819191 17:50350747-50350769 TGGTGAAAAGCAGAGGAGGAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150566764 17:66348761-66348783 GGTTGAACAGCAGAGGGGGAGGG + Intronic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152245162 17:79181652-79181674 GGGTGGCCAGCAGTGGCAGAGGG - Intronic
1152485096 17:80585592-80585614 CGGTGCACAGCACTTGCGTAGGG + Intronic
1152623927 17:81379802-81379824 GGGTGAACAGCAGTGGAGGGTGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154484876 18:14865564-14865586 TGGTGAACAGGAGGGACGGAAGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1155783051 18:29863416-29863438 CTGTGAAAAACAGTGGCAGAAGG - Intergenic
1156869135 18:41924743-41924765 AGGAGAACAGCAGTGGCAGTAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157738440 18:50071206-50071228 GGGTGAATAACAGTGGAGGAAGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158404287 18:57147301-57147323 CGGTGCGCAGCCATGGCGGACGG + Exonic
1158580908 18:58681951-58681973 TGGTCTACAGCAGTGGTGGAGGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163633611 19:18428813-18428835 GGGTGAACAGCAGTGACGCCAGG - Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165823193 19:38690264-38690286 CGGTGAACAGCAGTGAAGGATGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925384973 2:3455494-3455516 CTGGGAACAGTAGTGGGGGATGG - Intronic
925684628 2:6458580-6458602 TGGTGAAGAGCAGGGGTGGAGGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927826353 2:26312423-26312445 TGGTGACCAGCAGTGGTAGAGGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932420725 2:71599798-71599820 TGGTGAACAGGGGTGGGGGAAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934624283 2:95834496-95834518 CTGAGAACAGCAGGGGCGGGTGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940784021 2:157962894-157962916 CGGTGAACAGGAGCGGGGGCTGG - Intronic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942026337 2:171914194-171914216 CAGGGAATAGCTGTGGCGGAAGG - Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942831223 2:180238913-180238935 TGTTGAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945193965 2:207220525-207220547 AGGTTAACAGCAGTGGCACATGG + Intergenic
948273346 2:236690479-236690501 CGGTGAACTGCAGATGCGGGTGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172186517 20:33034487-33034509 CATTGAACAGTGGTGGCGGATGG + Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173082097 20:39877964-39877986 GTCTGAACAGCAGTGGGGGAAGG - Intergenic
1175080594 20:56417348-56417370 CGGGGAACAGCAGGGGAGAAGGG - Intronic
1175444823 20:59012856-59012878 CGGGGAACAGGAGAGACGGAGGG + Intergenic
1175445756 20:59018376-59018398 CGGTGTACAGGAGTGGCAGCAGG - Intergenic
1175477288 20:59285841-59285863 CCGTGCACAGCAGTGGCAGAGGG + Intergenic
1176219638 20:63963887-63963909 CCCTGAAGAGCAGTGGCAGAGGG - Exonic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178899665 21:36588931-36588953 CTGGGAAAAGCAGTGGCGGGAGG - Intergenic
1178940582 21:36901963-36901985 CTGTGGACAGCAGTGGGGGGCGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1181468933 22:23126345-23126367 AGGTGAACTGCAGGGGAGGACGG - Intronic
1182349637 22:29692092-29692114 GGGCGAGCAGCAGTGGCCGAAGG + Intronic
1183168275 22:36164294-36164316 CGGTTAACAGAAGTGGGGGCTGG - Intronic
1183329537 22:37211987-37212009 CTGTGGACAGCCGTGGCCGAGGG - Exonic
1184195437 22:42924600-42924622 GGGTGGACAGCAGTGGTGGCGGG - Intronic
1184428309 22:44425908-44425930 GGATGAACAGCAGAGGCCGAAGG + Intergenic
1184648241 22:45907786-45907808 AGGTGATCAGCAGTGGCAGACGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954457494 3:50607761-50607783 AGGTGTACAGCAGTGGCTGGTGG + Exonic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
958936451 3:100261007-100261029 ACGTCAACAGCAATGGCGGAAGG + Exonic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962279716 3:134040519-134040541 AGGAGAAAAGCAGTGCCGGAAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963827455 3:149970704-149970726 CGGTGAGGACCAGTGGCGGCCGG - Exonic
968390877 4:192146-192168 TGGTGATCAGCAGTGGTGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974121105 4:57640209-57640231 CAGTGAGCAGCAGTGCGGGATGG + Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975644089 4:76529012-76529034 CTGTGAACATCAGCGGCAGATGG - Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980889457 4:138798568-138798590 CTGGGAGCAGCAGTGGAGGAGGG + Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983537512 4:168873956-168873978 AGGGGAACAGCAGTGGCAGGTGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
986492622 5:8307849-8307871 TGGTGAACAGCAGTGGTGGATGG + Intergenic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997065659 5:130556008-130556030 TGGTGAAGAGCAGGGGCGGCAGG - Intergenic
997230588 5:132239565-132239587 CGGTGAATCGCAGAGGCTGAGGG + Intronic
1001401562 5:171449470-171449492 CGGGGAAGAGAAGTGGGGGATGG - Intronic
1002590847 5:180291243-180291265 CGGTGTCCAGCAGTGCCAGAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009229363 6:61043668-61043690 TGGTGAACAGCAGTGGGGGTGGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1009885202 6:69617025-69617047 GGGTGATCAGCAGTGGTGGACGG - Intergenic
1011189091 6:84712068-84712090 CGGTGAACAGCAGTGGCGGACGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013410504 6:109879599-109879621 TGGTGATCAGCAGTGGTGGACGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1018854809 6:167667690-167667712 CGGTGAACTGGAGTGGCTCACGG - Intergenic
1018913367 6:168117178-168117200 CCGTGAGCAGCAGCGGCTGATGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021690776 7:23228870-23228892 GGGTGACCAGCAGTGCCTGATGG + Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021991293 7:26143860-26143882 CAGTGCAGAGGAGTGGCGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025023111 7:55495416-55495438 TGGTGGACAGGAGTGGCGGCAGG - Intronic
1025234808 7:57227420-57227442 GGGAGAACTGCAGTGGCCGAGGG + Intergenic
1025478494 7:60956273-60956295 CCGTAAAAAGCCGTGGCGGAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026493372 7:70882205-70882227 CAGTGTACAACAGTGGCTGAAGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029525051 7:101089040-101089062 CGGCGAAGTGCAGTGGCGCAGGG + Exonic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1033174826 7:139114240-139114262 CTTTGAGCAGCAGTGGGGGAGGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1034973999 7:155437337-155437359 CAGTGCACAGCAGAGGCAGAGGG + Intergenic
1035256762 7:157634022-157634044 TGGGGAACAGCAGTGGAGGCGGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037773448 8:21817090-21817112 ACCTGAACAGCAGTGGAGGAGGG - Intergenic
1038181092 8:25228437-25228459 CAGTGTACAGCAGTGGCAGAGGG + Intronic
1038992070 8:32878797-32878819 GGGTGAACTGCAGTGAAGGAGGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040856947 8:51958319-51958341 CAGTGTACAGCAGTAGCAGAGGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045317765 8:101058075-101058097 CGGGGAACAGCAGCTGCTGAGGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046099059 8:109593831-109593853 GGGTGAAAGGCAGTGGGGGAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047771901 8:128036622-128036644 CTGTGAACTGCAGTGACGGGAGG - Intergenic
1048100260 8:131343232-131343254 TGGTGATCAGCAGCGGTGGACGG + Intergenic
1048629433 8:136225928-136225950 TGGTGAACAGCAATTGCAGAGGG - Intergenic
1048815806 8:138332641-138332663 CGGTGAAAAGCAGGGGCGTGTGG + Intronic
1051064215 9:13082507-13082529 CTGTGAACAGGAGTGGCGACTGG + Intergenic
1051329073 9:16004606-16004628 CGGTGAACTGCAGTTGCAAATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1061245589 9:129399879-129399901 CGGTAGACAGCAGTGGCAGAGGG + Intergenic
1062299609 9:135858040-135858062 TGGTGGACAGCAGTGCCTGAGGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186410576 X:9342218-9342240 GGGTGAAAAGCAGAGGGGGAGGG - Intergenic
1187770540 X:22690946-22690968 AGGTCAAGAGCAGTGGAGGATGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1188869669 X:35358898-35358920 TGGTGATGAGCAGTGGGGGATGG + Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197641681 X:128974990-128975012 CCATGGACAGCAGTGGGGGAGGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1200849217 Y:7865528-7865550 TGGTGACCAGCACTGGTGGATGG + Intergenic