ID: 1011190324 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:84720755-84720777 |
| Sequence | CAGCGAACAGCAGTGGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011190318_1011190324 | 13 | Left | 1011190318 | 6:84720719-84720741 | CCAGAGGGGTGGAAGTCAACGGT | 0: 2 1: 13 2: 64 3: 114 4: 167 |
||
| Right | 1011190324 | 6:84720755-84720777 | CAGCGAACAGCAGTGGTGGATGG | No data | ||||
| 1011190316_1011190324 | 19 | Left | 1011190316 | 6:84720713-84720735 | CCAGATCCAGAGGGGTGGAAGTC | 0: 28 1: 72 2: 82 3: 94 4: 145 |
||
| Right | 1011190324 | 6:84720755-84720777 | CAGCGAACAGCAGTGGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011190324 | Original CRISPR | CAGCGAACAGCAGTGGTGGA TGG | Intronic | ||
| No off target data available for this crispr | |||||