ID: 1011190324

View in Genome Browser
Species Human (GRCh38)
Location 6:84720755-84720777
Sequence CAGCGAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011190318_1011190324 13 Left 1011190318 6:84720719-84720741 CCAGAGGGGTGGAAGTCAACGGT 0: 2
1: 13
2: 64
3: 114
4: 167
Right 1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG No data
1011190316_1011190324 19 Left 1011190316 6:84720713-84720735 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011190324 Original CRISPR CAGCGAACAGCAGTGGTGGA TGG Intronic
No off target data available for this crispr