ID: 1011194376

View in Genome Browser
Species Human (GRCh38)
Location 6:84766610-84766632
Sequence CCGCCCCAATCCCAGGCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011194369_1011194376 7 Left 1011194369 6:84766580-84766602 CCAGAAGAAGTTCCGTTCAGCTG No data
Right 1011194376 6:84766610-84766632 CCGCCCCAATCCCAGGCTCTCGG No data
1011194371_1011194376 -5 Left 1011194371 6:84766592-84766614 CCGTTCAGCTGAGGTGCCCCGCC No data
Right 1011194376 6:84766610-84766632 CCGCCCCAATCCCAGGCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011194376 Original CRISPR CCGCCCCAATCCCAGGCTCT CGG Intergenic
No off target data available for this crispr