ID: 1011194936

View in Genome Browser
Species Human (GRCh38)
Location 6:84771861-84771883
Sequence AACCAAATAAAACTTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011194936_1011194938 13 Left 1011194936 6:84771861-84771883 CCAGGCAGAAGTTTTATTTGGTT No data
Right 1011194938 6:84771897-84771919 CCCCTTTGCGATCAATCGAGTGG No data
1011194936_1011194941 26 Left 1011194936 6:84771861-84771883 CCAGGCAGAAGTTTTATTTGGTT No data
Right 1011194941 6:84771910-84771932 AATCGAGTGGTCGCCAGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011194936 Original CRISPR AACCAAATAAAACTTCTGCC TGG (reversed) Intergenic
No off target data available for this crispr