ID: 1011195323 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:84774337-84774359 |
Sequence | GAGTCGGGGCGCGGGCGCCG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1011195323_1011195336 | 14 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
Right | 1011195336 | 6:84774374-84774396 | TCTCCAGGCCCGGCTGTCTCCGG | No data | ||||
1011195323_1011195331 | -1 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
Right | 1011195331 | 6:84774359-84774381 | CTCCGGTCCCGGCTCTCTCCAGG | No data | ||||
1011195323_1011195333 | 4 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
Right | 1011195333 | 6:84774364-84774386 | GTCCCGGCTCTCTCCAGGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1011195323 | Original CRISPR | GAGTCGGGGCGCGGGCGCCG CGG (reversed) | Intergenic | ||