ID: 1011195323 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:84774337-84774359 |
| Sequence | GAGTCGGGGCGCGGGCGCCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1011195323_1011195333 | 4 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
| Right | 1011195333 | 6:84774364-84774386 | GTCCCGGCTCTCTCCAGGCCCGG | No data | ||||
| 1011195323_1011195331 | -1 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
| Right | 1011195331 | 6:84774359-84774381 | CTCCGGTCCCGGCTCTCTCCAGG | No data | ||||
| 1011195323_1011195336 | 14 | Left | 1011195323 | 6:84774337-84774359 | CCGCGGCGCCCGCGCCCCGACTC | No data | ||
| Right | 1011195336 | 6:84774374-84774396 | TCTCCAGGCCCGGCTGTCTCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1011195323 | Original CRISPR | GAGTCGGGGCGCGGGCGCCG CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||