ID: 1011195323

View in Genome Browser
Species Human (GRCh38)
Location 6:84774337-84774359
Sequence GAGTCGGGGCGCGGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011195323_1011195333 4 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195323_1011195331 -1 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195323_1011195336 14 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011195323 Original CRISPR GAGTCGGGGCGCGGGCGCCG CGG (reversed) Intergenic
No off target data available for this crispr