ID: 1011195331

View in Genome Browser
Species Human (GRCh38)
Location 6:84774359-84774381
Sequence CTCCGGTCCCGGCTCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011195318_1011195331 20 Left 1011195318 6:84774316-84774338 CCTCCTTGCGGCTCCGAGCCTCC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195319_1011195331 17 Left 1011195319 6:84774319-84774341 CCTTGCGGCTCCGAGCCTCCGCG No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195322_1011195331 2 Left 1011195322 6:84774334-84774356 CCTCCGCGGCGCCCGCGCCCCGA No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195325_1011195331 -9 Left 1011195325 6:84774345-84774367 CCCGCGCCCCGACTCTCCGGTCC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195317_1011195331 26 Left 1011195317 6:84774310-84774332 CCTGGGCCTCCTTGCGGCTCCGA No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195323_1011195331 -1 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195326_1011195331 -10 Left 1011195326 6:84774346-84774368 CCGCGCCCCGACTCTCCGGTCCC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data
1011195321_1011195331 7 Left 1011195321 6:84774329-84774351 CCGAGCCTCCGCGGCGCCCGCGC No data
Right 1011195331 6:84774359-84774381 CTCCGGTCCCGGCTCTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011195331 Original CRISPR CTCCGGTCCCGGCTCTCTCC AGG Intergenic
No off target data available for this crispr