ID: 1011195333

View in Genome Browser
Species Human (GRCh38)
Location 6:84774364-84774386
Sequence GTCCCGGCTCTCTCCAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011195321_1011195333 12 Left 1011195321 6:84774329-84774351 CCGAGCCTCCGCGGCGCCCGCGC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195318_1011195333 25 Left 1011195318 6:84774316-84774338 CCTCCTTGCGGCTCCGAGCCTCC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195322_1011195333 7 Left 1011195322 6:84774334-84774356 CCTCCGCGGCGCCCGCGCCCCGA No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195326_1011195333 -5 Left 1011195326 6:84774346-84774368 CCGCGCCCCGACTCTCCGGTCCC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195328_1011195333 -10 Left 1011195328 6:84774351-84774373 CCCCGACTCTCCGGTCCCGGCTC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195319_1011195333 22 Left 1011195319 6:84774319-84774341 CCTTGCGGCTCCGAGCCTCCGCG No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195325_1011195333 -4 Left 1011195325 6:84774345-84774367 CCCGCGCCCCGACTCTCCGGTCC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data
1011195323_1011195333 4 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195333 6:84774364-84774386 GTCCCGGCTCTCTCCAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011195333 Original CRISPR GTCCCGGCTCTCTCCAGGCC CGG Intergenic
No off target data available for this crispr