ID: 1011195336

View in Genome Browser
Species Human (GRCh38)
Location 6:84774374-84774396
Sequence TCTCCAGGCCCGGCTGTCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011195330_1011195336 -2 Left 1011195330 6:84774353-84774375 CCGACTCTCCGGTCCCGGCTCTC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195323_1011195336 14 Left 1011195323 6:84774337-84774359 CCGCGGCGCCCGCGCCCCGACTC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195322_1011195336 17 Left 1011195322 6:84774334-84774356 CCTCCGCGGCGCCCGCGCCCCGA No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195328_1011195336 0 Left 1011195328 6:84774351-84774373 CCCCGACTCTCCGGTCCCGGCTC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195326_1011195336 5 Left 1011195326 6:84774346-84774368 CCGCGCCCCGACTCTCCGGTCCC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195329_1011195336 -1 Left 1011195329 6:84774352-84774374 CCCGACTCTCCGGTCCCGGCTCT No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195321_1011195336 22 Left 1011195321 6:84774329-84774351 CCGAGCCTCCGCGGCGCCCGCGC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195325_1011195336 6 Left 1011195325 6:84774345-84774367 CCCGCGCCCCGACTCTCCGGTCC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data
1011195332_1011195336 -10 Left 1011195332 6:84774361-84774383 CCGGTCCCGGCTCTCTCCAGGCC No data
Right 1011195336 6:84774374-84774396 TCTCCAGGCCCGGCTGTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011195336 Original CRISPR TCTCCAGGCCCGGCTGTCTC CGG Intergenic
No off target data available for this crispr