ID: 1011195479

View in Genome Browser
Species Human (GRCh38)
Location 6:84774901-84774923
Sequence ACGCCAGGCAGTGCGGCGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011195479_1011195493 30 Left 1011195479 6:84774901-84774923 CCGTCCGCCGCACTGCCTGGCGT No data
Right 1011195493 6:84774954-84774976 ACCTCCCGCCGTCTCAGGCTCGG No data
1011195479_1011195485 -9 Left 1011195479 6:84774901-84774923 CCGTCCGCCGCACTGCCTGGCGT No data
Right 1011195485 6:84774915-84774937 GCCTGGCGTCCTGCCTGGGGAGG No data
1011195479_1011195492 25 Left 1011195479 6:84774901-84774923 CCGTCCGCCGCACTGCCTGGCGT No data
Right 1011195492 6:84774949-84774971 CCAGCACCTCCCGCCGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011195479 Original CRISPR ACGCCAGGCAGTGCGGCGGA CGG (reversed) Intergenic
No off target data available for this crispr