ID: 1011197617

View in Genome Browser
Species Human (GRCh38)
Location 6:84798319-84798341
Sequence TCCACAGATGTGTCCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011197617_1011197621 18 Left 1011197617 6:84798319-84798341 CCTTCTGTGGACACATCTGTGGA No data
Right 1011197621 6:84798360-84798382 GTCCACCTGGAATCAACTGAAGG No data
1011197617_1011197619 5 Left 1011197617 6:84798319-84798341 CCTTCTGTGGACACATCTGTGGA No data
Right 1011197619 6:84798347-84798369 TGTGTGCCAAGAAGTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011197617 Original CRISPR TCCACAGATGTGTCCACAGA AGG (reversed) Intergenic
No off target data available for this crispr