ID: 1011202664

View in Genome Browser
Species Human (GRCh38)
Location 6:84854549-84854571
Sequence CCTCATCGAAACCAGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011202657_1011202664 18 Left 1011202657 6:84854508-84854530 CCTAATTCCAACTGCAGTGAACA No data
Right 1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG No data
1011202660_1011202664 11 Left 1011202660 6:84854515-84854537 CCAACTGCAGTGAACATTTGGGG No data
Right 1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG No data
1011202655_1011202664 20 Left 1011202655 6:84854506-84854528 CCCCTAATTCCAACTGCAGTGAA No data
Right 1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG No data
1011202654_1011202664 21 Left 1011202654 6:84854505-84854527 CCCCCTAATTCCAACTGCAGTGA No data
Right 1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG No data
1011202656_1011202664 19 Left 1011202656 6:84854507-84854529 CCCTAATTCCAACTGCAGTGAAC No data
Right 1011202664 6:84854549-84854571 CCTCATCGAAACCAGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011202664 Original CRISPR CCTCATCGAAACCAGCATCT TGG Intergenic
No off target data available for this crispr