ID: 1011208433

View in Genome Browser
Species Human (GRCh38)
Location 6:84927656-84927678
Sequence AAGCTGTCCCTATTATAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011208433_1011208435 -7 Left 1011208433 6:84927656-84927678 CCTATTTATAATAGGGACAGCTT No data
Right 1011208435 6:84927672-84927694 ACAGCTTGGAGAATAGTGACTGG No data
1011208433_1011208436 -4 Left 1011208433 6:84927656-84927678 CCTATTTATAATAGGGACAGCTT No data
Right 1011208436 6:84927675-84927697 GCTTGGAGAATAGTGACTGGAGG No data
1011208433_1011208438 27 Left 1011208433 6:84927656-84927678 CCTATTTATAATAGGGACAGCTT No data
Right 1011208438 6:84927706-84927728 TTCATATTTATTTAACAATGAGG No data
1011208433_1011208437 -3 Left 1011208433 6:84927656-84927678 CCTATTTATAATAGGGACAGCTT No data
Right 1011208437 6:84927676-84927698 CTTGGAGAATAGTGACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011208433 Original CRISPR AAGCTGTCCCTATTATAAAT AGG (reversed) Intergenic
No off target data available for this crispr