ID: 1011209228

View in Genome Browser
Species Human (GRCh38)
Location 6:84936712-84936734
Sequence CCTCCTCAAGTGTGTCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011209224_1011209228 15 Left 1011209224 6:84936674-84936696 CCCAGCATGGCGTTCAATCTCTG No data
Right 1011209228 6:84936712-84936734 CCTCCTCAAGTGTGTCCCTGAGG No data
1011209225_1011209228 14 Left 1011209225 6:84936675-84936697 CCAGCATGGCGTTCAATCTCTGA No data
Right 1011209228 6:84936712-84936734 CCTCCTCAAGTGTGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011209228 Original CRISPR CCTCCTCAAGTGTGTCCCTG AGG Intergenic
No off target data available for this crispr