ID: 1011224248

View in Genome Browser
Species Human (GRCh38)
Location 6:85089382-85089404
Sequence TGTTAAGGAGTGCAGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011224243_1011224248 -1 Left 1011224243 6:85089360-85089382 CCATTCACAGCTGTATACAAGAT No data
Right 1011224248 6:85089382-85089404 TGTTAAGGAGTGCAGTGGAGGGG No data
1011224241_1011224248 27 Left 1011224241 6:85089332-85089354 CCCTCAGATTAATTGGCACTGAT No data
Right 1011224248 6:85089382-85089404 TGTTAAGGAGTGCAGTGGAGGGG No data
1011224242_1011224248 26 Left 1011224242 6:85089333-85089355 CCTCAGATTAATTGGCACTGATA No data
Right 1011224248 6:85089382-85089404 TGTTAAGGAGTGCAGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011224248 Original CRISPR TGTTAAGGAGTGCAGTGGAG GGG Intergenic
No off target data available for this crispr