ID: 1011228859

View in Genome Browser
Species Human (GRCh38)
Location 6:85137510-85137532
Sequence TGCCTGTCCCGCGGAGCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011228859_1011228864 1 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228864 6:85137534-85137556 AGGATGGGCAAAGTGTACTTTGG No data
1011228859_1011228869 16 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228869 6:85137549-85137571 TACTTTGGTGGGCAGGATGAGGG No data
1011228859_1011228867 9 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228867 6:85137542-85137564 CAAAGTGTACTTTGGTGGGCAGG No data
1011228859_1011228870 17 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228870 6:85137550-85137572 ACTTTGGTGGGCAGGATGAGGGG No data
1011228859_1011228865 4 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228865 6:85137537-85137559 ATGGGCAAAGTGTACTTTGGTGG No data
1011228859_1011228866 5 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228866 6:85137538-85137560 TGGGCAAAGTGTACTTTGGTGGG No data
1011228859_1011228868 15 Left 1011228859 6:85137510-85137532 CCTAGGGCTCCGCGGGACAGGCA No data
Right 1011228868 6:85137548-85137570 GTACTTTGGTGGGCAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011228859 Original CRISPR TGCCTGTCCCGCGGAGCCCT AGG (reversed) Intergenic
No off target data available for this crispr