ID: 1011230162

View in Genome Browser
Species Human (GRCh38)
Location 6:85151719-85151741
Sequence CAGTTTTTCACCATTGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011230161_1011230162 6 Left 1011230161 6:85151690-85151712 CCTTATTTCTAATCTTAGAAAAA No data
Right 1011230162 6:85151719-85151741 CAGTTTTTCACCATTGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011230162 Original CRISPR CAGTTTTTCACCATTGAGTA TGG Intergenic
No off target data available for this crispr