ID: 1011239499

View in Genome Browser
Species Human (GRCh38)
Location 6:85255936-85255958
Sequence TAGCTCAGGCTGACATAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011239499_1011239502 -2 Left 1011239499 6:85255936-85255958 CCAGCCTATGTCAGCCTGAGCTA No data
Right 1011239502 6:85255957-85255979 TAATAGCCCCTGAAGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011239499 Original CRISPR TAGCTCAGGCTGACATAGGC TGG (reversed) Intergenic
No off target data available for this crispr