ID: 1011247700

View in Genome Browser
Species Human (GRCh38)
Location 6:85336938-85336960
Sequence TAGGGTATGAGACATGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011247695_1011247700 6 Left 1011247695 6:85336909-85336931 CCAGATCCTGGGGGACATTGTAA No data
Right 1011247700 6:85336938-85336960 TAGGGTATGAGACATGTATCAGG No data
1011247696_1011247700 0 Left 1011247696 6:85336915-85336937 CCTGGGGGACATTGTAAGCCTGT No data
Right 1011247700 6:85336938-85336960 TAGGGTATGAGACATGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011247700 Original CRISPR TAGGGTATGAGACATGTATC AGG Intergenic
No off target data available for this crispr