ID: 1011254606

View in Genome Browser
Species Human (GRCh38)
Location 6:85407658-85407680
Sequence TGTAGGTGATCTGTAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011254606_1011254612 0 Left 1011254606 6:85407658-85407680 CCCTCTCCTACAGATCACCTACA No data
Right 1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG No data
1011254606_1011254611 -1 Left 1011254606 6:85407658-85407680 CCCTCTCCTACAGATCACCTACA No data
Right 1011254611 6:85407680-85407702 ATTGGCTAATGCTGCTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011254606 Original CRISPR TGTAGGTGATCTGTAGGAGA GGG (reversed) Intergenic
No off target data available for this crispr