ID: 1011254612

View in Genome Browser
Species Human (GRCh38)
Location 6:85407681-85407703
Sequence TTGGCTAATGCTGCTCTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011254609_1011254612 -6 Left 1011254609 6:85407664-85407686 CCTACAGATCACCTACATTGGCT No data
Right 1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG No data
1011254606_1011254612 0 Left 1011254606 6:85407658-85407680 CCCTCTCCTACAGATCACCTACA No data
Right 1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG No data
1011254607_1011254612 -1 Left 1011254607 6:85407659-85407681 CCTCTCCTACAGATCACCTACAT No data
Right 1011254612 6:85407681-85407703 TTGGCTAATGCTGCTCTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011254612 Original CRISPR TTGGCTAATGCTGCTCTTGT GGG Intergenic
No off target data available for this crispr