ID: 1011255249

View in Genome Browser
Species Human (GRCh38)
Location 6:85414135-85414157
Sequence TATAGGCATGCGCCACCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011255247_1011255249 -7 Left 1011255247 6:85414119-85414141 CCCAACTAGCTTGGATTATAGGC No data
Right 1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG No data
1011255245_1011255249 -4 Left 1011255245 6:85414116-85414138 CCTCCCAACTAGCTTGGATTATA No data
Right 1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG No data
1011255248_1011255249 -8 Left 1011255248 6:85414120-85414142 CCAACTAGCTTGGATTATAGGCA No data
Right 1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG No data
1011255243_1011255249 2 Left 1011255243 6:85414110-85414132 CCTCAGCCTCCCAACTAGCTTGG 0: 12
1: 1426
2: 101865
3: 217570
4: 357030
Right 1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG No data
1011255242_1011255249 25 Left 1011255242 6:85414087-85414109 CCTGAGTTCAAGTGATTCTCTTG 0: 111
1: 4543
2: 50644
3: 124554
4: 174204
Right 1011255249 6:85414135-85414157 TATAGGCATGCGCCACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011255249 Original CRISPR TATAGGCATGCGCCACCACC AGG Intergenic
No off target data available for this crispr