ID: 1011258217

View in Genome Browser
Species Human (GRCh38)
Location 6:85445710-85445732
Sequence GGAGGACCATCAGTCTATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011258217_1011258223 16 Left 1011258217 6:85445710-85445732 CCAATATAGACTGATGGTCCTCC No data
Right 1011258223 6:85445749-85445771 TCACGGCAAAGTTGCAAGAAAGG No data
1011258217_1011258221 -1 Left 1011258217 6:85445710-85445732 CCAATATAGACTGATGGTCCTCC No data
Right 1011258221 6:85445732-85445754 CTATGGCCACAAAGAGATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011258217 Original CRISPR GGAGGACCATCAGTCTATAT TGG (reversed) Intergenic
No off target data available for this crispr