ID: 1011258221

View in Genome Browser
Species Human (GRCh38)
Location 6:85445732-85445754
Sequence CTATGGCCACAAAGAGATCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011258217_1011258221 -1 Left 1011258217 6:85445710-85445732 CCAATATAGACTGATGGTCCTCC No data
Right 1011258221 6:85445732-85445754 CTATGGCCACAAAGAGATCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011258221 Original CRISPR CTATGGCCACAAAGAGATCA CGG Intergenic
No off target data available for this crispr