ID: 1011261635

View in Genome Browser
Species Human (GRCh38)
Location 6:85476277-85476299
Sequence TCCCATTTCAGTTTTGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1011261635_1011261646 14 Left 1011261635 6:85476277-85476299 CCATGTCCAAAACTGAAATGGGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1011261646 6:85476314-85476336 CCTTCGTGGGACTCATGAAGGGG 0: 1
1: 6
2: 8
3: 32
4: 128
1011261635_1011261638 1 Left 1011261635 6:85476277-85476299 CCATGTCCAAAACTGAAATGGGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1011261638 6:85476301-85476323 AGTTCCCTTGACCCCTTCGTGGG 0: 2
1: 17
2: 55
3: 157
4: 372
1011261635_1011261642 12 Left 1011261635 6:85476277-85476299 CCATGTCCAAAACTGAAATGGGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1011261642 6:85476312-85476334 CCCCTTCGTGGGACTCATGAAGG 0: 1
1: 5
2: 8
3: 33
4: 115
1011261635_1011261637 0 Left 1011261635 6:85476277-85476299 CCATGTCCAAAACTGAAATGGGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1011261637 6:85476300-85476322 TAGTTCCCTTGACCCCTTCGTGG 0: 4
1: 14
2: 33
3: 38
4: 100
1011261635_1011261644 13 Left 1011261635 6:85476277-85476299 CCATGTCCAAAACTGAAATGGGA 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1011261644 6:85476313-85476335 CCCTTCGTGGGACTCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1011261635 Original CRISPR TCCCATTTCAGTTTTGGACA TGG (reversed) Intronic
900894056 1:5470554-5470576 TCCCATCACTGCTTTGGACAGGG + Intergenic
901303823 1:8217968-8217990 TCCCATTTTATTTTGAGACAGGG - Intergenic
905465578 1:38150756-38150778 TCCAAGTTCAGTTTGGGACTCGG + Intergenic
906687399 1:47771517-47771539 TCCCATGTCAGCTGTGGACTTGG + Intronic
910063256 1:83119310-83119332 TCCCATTACAGTTCAGAACAGGG - Intergenic
910136534 1:83978392-83978414 TCTCATTTGAGCTTTGGATAGGG - Intronic
914454129 1:147819672-147819694 TCGAATTTCAGTTTTGGATTAGG - Intergenic
916433313 1:164753530-164753552 TGCTATTTCAGTTTTAGAAAAGG + Intronic
919163195 1:193858563-193858585 TGCTATTTTTGTTTTGGACAGGG - Intergenic
919163260 1:193859350-193859372 TGCTATTTTTGTTTTGGACAGGG + Intergenic
919310300 1:195898189-195898211 ACATATTTCAGTTTTGGAAAGGG + Intergenic
921281948 1:213576001-213576023 ATCCATTTCAGTCTTGGAAAGGG - Intergenic
924928337 1:248705291-248705313 TCCCATGTCAAAGTTGGACATGG + Intergenic
1063723676 10:8612991-8613013 GTCATTTTCAGTTTTGGACAAGG - Intergenic
1065855749 10:29828599-29828621 CCCCATTTCACTTTTGGCCCAGG - Intergenic
1066451372 10:35533181-35533203 TCCTCTTTCAGTTTTGGAGAGGG + Intronic
1068412835 10:56679700-56679722 CACCATTTCAGCTTTGGAAATGG - Intergenic
1070688732 10:78509274-78509296 TCCCATTTCACAGATGGACAAGG + Intergenic
1073864846 10:107790386-107790408 TTCTCTTTCAGTTTTGGACTGGG - Intergenic
1075800396 10:125150122-125150144 TCCTATTTCAGGTGTGCACATGG + Intronic
1078953287 11:16160300-16160322 TCCCATTTGAGTGAAGGACATGG - Intronic
1079507892 11:21174843-21174865 TCATATTTCAGTTATGGAGAGGG - Intronic
1079614879 11:22479952-22479974 TCCCATTCCAGTTTATCACATGG + Intergenic
1080053594 11:27882449-27882471 GGCCATTCCAGTTTTGGAGAGGG + Intergenic
1086054010 11:82626874-82626896 TCCCCATTCTGTTTTGGTCAGGG - Intergenic
1087362871 11:97182805-97182827 TCCCCTTTCAGTTTTTAACAGGG + Intergenic
1087950571 11:104215923-104215945 TCCACTTTCAGCATTGGACAGGG - Intergenic
1089862303 11:121600714-121600736 TCTCATTTCATTTTTAGATAAGG - Intronic
1090921810 11:131213356-131213378 TTCCATTACATTTTTGGAAAGGG + Intergenic
1090995949 11:131866262-131866284 TCCCATGTAAATTTGGGACAAGG - Intronic
1091502767 12:1035259-1035281 CCCCATTTCAGTTTGAGACTGGG + Intronic
1091605938 12:1951475-1951497 TCCCAAGTCAGTGATGGACATGG + Intronic
1092636292 12:10454343-10454365 TCCCTTTTCAGGTCTGGAGATGG - Exonic
1094092034 12:26661358-26661380 TCCCCTCTCAGTCTTGGCCAGGG - Intronic
1098157414 12:67613939-67613961 GCCTATTTCAGTTTTGCTCAAGG + Intergenic
1098202251 12:68068526-68068548 TCCCATTGCAGTATTGGAGCAGG - Intergenic
1104306624 12:127615759-127615781 TCCCCATTCTGTTTTGGTCAGGG - Intergenic
1104535096 12:129611434-129611456 CCCCATTTCAGTTGTAGACAAGG - Intronic
1106419043 13:29570328-29570350 TCCCATTTCATATTTGCTCACGG + Intronic
1107000865 13:35543704-35543726 TCCCATCTCCTTTTTGGAGATGG + Intronic
1108150795 13:47531747-47531769 ATCCATTTCAGTTTTGGGTAAGG - Intergenic
1111651330 13:91094172-91094194 AGCAAGTTCAGTTTTGGACATGG - Intergenic
1111673391 13:91357170-91357192 TCCCAATTCAGGTTTGGAAGGGG - Intergenic
1112961036 13:105126637-105126659 ACCCATTTAATTTTTGGAAATGG + Intergenic
1112986771 13:105459703-105459725 TCAAATTTCTATTTTGGACATGG - Intergenic
1114688742 14:24560488-24560510 TCCCTTATCCTTTTTGGACAAGG + Intergenic
1115344078 14:32323508-32323530 TCCCATTTCAGATGTAGCCAGGG - Intergenic
1115576653 14:34717864-34717886 TCCTATTTCTGTGCTGGACAAGG - Intergenic
1117003704 14:51396880-51396902 TTCCAGTTCAGTTTTGCAGAAGG + Intergenic
1117901800 14:60542104-60542126 TTCGATTTAAGTTTGGGACATGG + Intergenic
1118273247 14:64362957-64362979 TACCATTTCTTTTTGGGACAGGG - Intergenic
1118520736 14:66582278-66582300 TCCCATTTCAGTTTTACTCTTGG - Intronic
1120009901 14:79401921-79401943 TCTCATTTTATTTTTAGACAGGG + Intronic
1122162083 14:99792287-99792309 TACCATTTCAGATTTTGGCATGG + Intronic
1123927690 15:25134378-25134400 TCCCTTTTCAGATATGTACATGG - Intergenic
1124566951 15:30824777-30824799 TACCTCTTCAGTTTTGGTCATGG - Intergenic
1125998001 15:44182798-44182820 TCACATTTCATTTTTTGAGACGG + Intronic
1126453939 15:48840957-48840979 TGACATTACAATTTTGGACAAGG + Intronic
1127278697 15:57470193-57470215 TCCCATTTCACTTTTGCCTATGG - Intronic
1127462822 15:59215327-59215349 TCCCATTTCAGTTCTCAAAATGG + Intronic
1130228732 15:82080467-82080489 TCCTATTTCTGTCTTGGCCAGGG + Intergenic
1130868398 15:87951453-87951475 TTCCAGTTCATTTGTGGACATGG + Intronic
1131783309 15:95883377-95883399 TCCAATTCCATTATTGGACAAGG + Intergenic
1132466426 16:79414-79436 TCCCATTACAGTTTTGCCGACGG + Exonic
1132933042 16:2468377-2468399 TCGCATTTCAGCTTTTGACTTGG + Intergenic
1134056534 16:11173767-11173789 TCACCTGTCAGTTTTAGACATGG - Intronic
1138919868 16:61514132-61514154 TCCCATTTAAAGTTTGGAGAGGG + Intergenic
1139121751 16:64027114-64027136 TTCCATTTCAGTTTTCAGCAAGG + Intergenic
1140346344 16:74216697-74216719 TCCCATGACAGTGTGGGACATGG - Intergenic
1140872284 16:79118072-79118094 GCCTATGTCAGTTTTCGACATGG + Intronic
1141135619 16:81463334-81463356 GGCCATTTCAGATTTAGACATGG + Intronic
1143667182 17:8369993-8370015 ACACATCTCAGTATTGGACATGG - Exonic
1144679190 17:17181728-17181750 TCCCATGTCACTTATAGACATGG - Intronic
1145025342 17:19464052-19464074 TCACATTGCAGTTTTCTACAGGG - Intergenic
1145804555 17:27717236-27717258 TCCCCATTCTGTTTTGGCCAGGG - Intergenic
1149044934 17:52234097-52234119 CCAGATTTCATTTTTGGACAAGG - Intergenic
1149398693 17:56271559-56271581 CCCCATTTCTGTCTTGGATAAGG + Intronic
1149858453 17:60106274-60106296 TCACATTTCATTTGTGAACATGG + Intergenic
1152777124 17:82209128-82209150 TCTTATTTCAGTTTTAGAAATGG - Intronic
1155770763 18:29695229-29695251 TCACATTTCACTAATGGACATGG + Intergenic
1156294741 18:35779157-35779179 TCATTTTTCAGGTTTGGACAGGG + Intergenic
1157769267 18:50331093-50331115 TCCCTTTTGAGTTTTGTATATGG + Intergenic
1157784339 18:50468675-50468697 TCCACTTTCACTTTTGGACATGG + Intergenic
1158440451 18:57470411-57470433 TCCCATTTTACTCTTGGAGAAGG - Intronic
1159332734 18:67020677-67020699 TCTTTTTTCAGTTTTGAACATGG - Intergenic
1160032402 18:75273849-75273871 TCCCATTTCCATTTTGGGAATGG + Intronic
1162128089 19:8510343-8510365 TCCCATTTGGTTTCTGGACAAGG + Exonic
1163303910 19:16465232-16465254 TTCCATTTGGGTGTTGGACATGG - Intronic
926404997 2:12542349-12542371 TCTCATCTCAGATTTAGACAGGG - Intergenic
927578307 2:24219119-24219141 TCCCAGTTATGTTTTGGACAAGG - Intronic
928277514 2:29916551-29916573 TCCCATTTCATTTCTGGAGTGGG - Intronic
928801727 2:35102095-35102117 TCCCATTTCAAATTTTTACATGG + Intergenic
929663257 2:43811527-43811549 TTTCATTTCAGGTTTGTACATGG + Intergenic
930347900 2:50208476-50208498 TCCCTTTCCAGTTTTGAAAAGGG + Intronic
932951013 2:76293572-76293594 GCCTATCTCAGTTTTTGACATGG + Intergenic
940766176 2:157791810-157791832 TCAAATTTCAGTTTTGCAGAGGG - Intronic
941556111 2:166984254-166984276 TCATATTTCAGTTTTCTACAAGG + Intronic
942301195 2:174564064-174564086 TCTAATTACAGCTTTGGACAAGG - Intronic
942974834 2:182003484-182003506 TTTTATTTCATTTTTGGACATGG + Intronic
946102523 2:217338337-217338359 TCCCATTTCAGCTTTGCATGTGG + Intronic
948579969 2:238980213-238980235 TCCAATTTCATTTTTCCACATGG + Intergenic
1171473287 20:25389627-25389649 TCCCATCTCAGTTTTGAAAGTGG + Intronic
1173021123 20:39268977-39268999 TCCCTTTTCAGCCATGGACACGG - Intergenic
1173115263 20:40235827-40235849 TCTGATTTCAGTCTTAGACAAGG - Intergenic
1175437134 20:58961401-58961423 TCCCCTTTCAGTTTGGCAAAAGG + Intergenic
1177047967 21:16194559-16194581 TTCCATTTCAGTTTTGCCTATGG - Intergenic
1178922110 21:36745554-36745576 TCCCATGCCAGTTTTGGAAGTGG + Intronic
1181981693 22:26771495-26771517 CCACATTTCAGTTATGCACAGGG - Intergenic
1182380669 22:29884133-29884155 TCACTTGTGAGTTTTGGACATGG + Intronic
1182860139 22:33552776-33552798 TCACATCTCAGTTTCGGAAATGG + Intronic
1184294547 22:43515389-43515411 TGCAATTTCAGTTTTGCACCTGG - Intergenic
949246351 3:1929335-1929357 TCCCATTTCATTTTTGAAAGTGG - Intergenic
951179814 3:19646072-19646094 TATCATTTCAGTTTTTGAAAAGG + Intergenic
954976272 3:54697897-54697919 TCTCATTTCACTTGTGGGCATGG + Intronic
955696252 3:61640357-61640379 GCCCATTTTAGTGTTGGAAATGG - Intronic
955721775 3:61889831-61889853 TCCCTTGTCAGTTCTGGAGAAGG + Intronic
959829060 3:110838402-110838424 TCCCATTCCATTTTTGGGAAAGG - Intergenic
961547184 3:127643078-127643100 TCCTTTTTCAGATTTGTACAGGG - Intronic
961866842 3:129959604-129959626 TTCCTTTTCTTTTTTGGACAGGG + Intergenic
962951411 3:140223084-140223106 TCTCAATTCAGTATGGGACATGG - Intronic
965518925 3:169653314-169653336 GCCCATTTCTGTTTTGTATAGGG - Intronic
966956410 3:184884827-184884849 TCCCTTTTCACTTTTGGACCTGG + Intronic
968115395 3:196085470-196085492 TCCCATTTTATTTTTTGAGAAGG - Intergenic
969682112 4:8649148-8649170 TCACATTTTAGTCTTGAACAGGG - Intergenic
971594165 4:28507549-28507571 TGCTATTTCTGTTTTGGAAACGG + Intergenic
971736282 4:30456641-30456663 GCCCATTTCAGTTGTGGCTATGG - Intergenic
975516773 4:75256803-75256825 TACCTTTTCAGTTATGGTCAGGG + Intergenic
976044274 4:80926997-80927019 TCTCATTTCAGTTCTGGCCCAGG + Intronic
980992594 4:139750834-139750856 TCCCACTTCAGTTTTTAAAAGGG - Intronic
981761148 4:148196295-148196317 CCCCAGCTCAGTCTTGGACATGG + Intronic
983305996 4:165987723-165987745 TCTCATGTCAGTTTTGCACTGGG + Intronic
983661723 4:170135847-170135869 TTCCATTCCAGCTTTGGATAGGG + Intergenic
986079597 5:4376211-4376233 TCCTATTTCAGTTTAGAAAAGGG + Intergenic
986610559 5:9562636-9562658 CACCGTTTCAGTTTTGGATAAGG + Intergenic
989644420 5:43614573-43614595 TCCCATTTCAGTTGTTGATCTGG - Intronic
990352771 5:54935289-54935311 TAGGACTTCAGTTTTGGACATGG + Intergenic
990631964 5:57680275-57680297 ACCCATTTCTGTTTTAGCCAGGG + Intergenic
990725115 5:58744899-58744921 TCCGATTTCAGTTTTTTTCAGGG + Intronic
991255396 5:64608031-64608053 TCCCCTTTAAGGTTAGGACAGGG + Intronic
992513539 5:77467055-77467077 TTCCATTTCTGATTTGGAGATGG - Intronic
993555071 5:89326498-89326520 TCAAATTTCACTTTTGTACAGGG + Intergenic
995528665 5:113071705-113071727 TCCCATTTCAGATGAGGAAATGG + Intronic
997129718 5:131264332-131264354 TTCCATTTCAGGTTTGGGCGAGG + Intronic
998705975 5:144761158-144761180 TCCCATTTCAGTCTTGGAAGGGG + Intergenic
999287615 5:150403561-150403583 GCCCATTACAGTTTTGGGCCAGG + Intronic
999771394 5:154778778-154778800 TCCACTTTCAGTTTGGAACATGG + Intronic
999940113 5:156533002-156533024 TGGCATTTCAGTTAAGGACAGGG - Intronic
1000577866 5:162997481-162997503 TAAAATTTCAGTTTTGGACTTGG + Intergenic
1003162108 6:3644877-3644899 GCCCATTTCAGATTTGGACCTGG - Intergenic
1004410238 6:15374799-15374821 TCTCATGTCTGTTTTGAACAGGG + Intronic
1005297963 6:24445340-24445362 TACAATTTCAGTTTTGTAGATGG + Intronic
1007030477 6:38621934-38621956 TCCCCATTCTGTTTTGGTCAGGG - Intronic
1007166809 6:39834239-39834261 TCTCATTTCAGATTTAGAGAGGG + Intronic
1008124511 6:47653647-47653669 TCCAATCTGAGTTTTGGGCAAGG + Intergenic
1008257976 6:49327948-49327970 TCCCAGTTCAGATATGGACCTGG - Intergenic
1008581785 6:52914456-52914478 CCTGATTTCAGTTTGGGACAGGG - Intergenic
1010832132 6:80543756-80543778 TCCCATTTCAGTTTGTGACTGGG - Intergenic
1011261635 6:85476277-85476299 TCCCATTTCAGTTTTGGACATGG - Intronic
1012081429 6:94762702-94762724 TCCAGTTTCAGTTTTCTACATGG - Intergenic
1013542899 6:111129171-111129193 GCCCATGTCAGTTTTGGAGCTGG + Intronic
1014693272 6:124587823-124587845 TCCCATTTCTGTTTTCTACAAGG - Intronic
1016957625 6:149641615-149641637 ACCCATTTCACTTATGAACATGG + Intronic
1018299339 6:162384203-162384225 ACCTGTCTCAGTTTTGGACATGG + Intronic
1018544985 6:164925278-164925300 TCCCAGTTCAGCTTTGTACCTGG + Intergenic
1018586540 6:165366776-165366798 TTCCATTTCTGTTTTGGCCTTGG - Intronic
1020453710 7:8347930-8347952 TCACATTTCTGTCTTGGAGATGG - Intergenic
1021438015 7:20643728-20643750 TCCCTTTGTAGTTTGGGACATGG - Intronic
1021553278 7:21894569-21894591 TTCTATTTCAGTTTTCGTCATGG - Intronic
1022285509 7:28953530-28953552 TCCCATTGCAAGTATGGACAAGG - Exonic
1022586219 7:31615188-31615210 TCCCATTTAGTCTTTGGACATGG + Intronic
1024435262 7:49345468-49345490 TCCCATCTAAATTTTGGTCAAGG + Intergenic
1024884892 7:54129585-54129607 TCACATTGCAGTTTTTGATAAGG + Intergenic
1026408772 7:70097074-70097096 ATGCATTTCAGCTTTGGACAAGG + Intronic
1028391845 7:90325990-90326012 TCCCATTTAATTTGTGTACATGG - Intergenic
1030267833 7:107638715-107638737 TCTCATTTGAATTTTGGTCAGGG + Intergenic
1031112328 7:117626310-117626332 TCCCATTTCACCTTTTGATAAGG + Intronic
1033007028 7:137576981-137577003 TCACAGTTCAGTTTTGAAGAAGG - Intronic
1033938809 7:146624718-146624740 TGCCATATAAGTTTTAGACATGG + Intronic
1035133858 7:156680752-156680774 TTCCATTTCAGTTTTATAGAGGG - Exonic
1035850158 8:2910989-2911011 TTGCATTTCAGTTATGGAAAGGG - Intergenic
1038296276 8:26292965-26292987 TCTCATTTCATTTTTCAACAAGG - Intronic
1038710923 8:29944734-29944756 TCCACTTTCAGTTTTTGAGATGG + Intergenic
1040796413 8:51293737-51293759 TCCCCATTCTGTTTTGGTCAGGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041779932 8:61566996-61567018 TACAATTTCAGTTTTAGAGATGG + Intronic
1042772333 8:72393487-72393509 TCCCCATTCTGTTTTGGCCAGGG - Intergenic
1044167606 8:89006470-89006492 TCCAATTAAAGTTTTAGACAAGG + Intergenic
1044739630 8:95312985-95313007 TCCGAGTTCAGTTTTGAACCTGG + Intergenic
1044769451 8:95615080-95615102 TCTCCTTTCAGTTTTTGGCAAGG + Intergenic
1046102985 8:109635787-109635809 TCCTATTTCTGTGTTGGACAGGG - Intronic
1046919250 8:119710322-119710344 TCCAATTTAAGTTTTGTATATGG + Intergenic
1047630741 8:126705104-126705126 TCCTATTTTAGCTTTTGACATGG + Intergenic
1048400804 8:134067641-134067663 TCCAATTTCAGTTTTGCAAGTGG + Intergenic
1051034479 9:12726992-12727014 TCCCATTTCACATTTCCACAAGG + Intergenic
1052831330 9:33218354-33218376 TTCCATTTCAGTTCTGCAAATGG + Intronic
1054971359 9:71091387-71091409 TCCCAGTTCAGGGTTGGAGAAGG + Intronic
1055712504 9:79078782-79078804 TCCCATTTCTCTTTTTGCCAAGG - Intergenic
1056896543 9:90556094-90556116 TCTGAGATCAGTTTTGGACACGG - Intergenic
1057387325 9:94615549-94615571 TACCATTTCTGTTGTAGACATGG - Intronic
1058302922 9:103398708-103398730 TCCCATTCCAGTCTTGTAAAGGG + Intergenic
1058793240 9:108471907-108471929 TCGCATTTTAATTTTGCACAGGG - Intergenic
1186670430 X:11761909-11761931 TCCCATTTCAGTTTACCACTCGG - Intronic
1187892444 X:23948828-23948850 TGATTTTTCAGTTTTGGACATGG - Intergenic
1188364364 X:29296444-29296466 TCCTATTTCTGTTTTGTACATGG + Intronic
1189392324 X:40586577-40586599 GCCCATTTCAGTTCAGTACAAGG + Intronic
1189852357 X:45190343-45190365 TCCCACCTCAGTTTTGGAGAAGG + Intronic
1189909441 X:45795087-45795109 TACCATTTAAGTTTTGCATATGG + Intergenic
1189935245 X:46060913-46060935 TCCAGTTTCAGTTTTGCATATGG + Intergenic
1191967118 X:66771222-66771244 TTTCATTTCAGTTTTGTATATGG + Intergenic
1193458950 X:81767030-81767052 TCCCATTTCAGCTTTCCTCATGG + Intergenic
1196810602 X:119626161-119626183 ACCCATTTCAGAATTGGAAAGGG + Intronic
1196882487 X:120211279-120211301 TTCCATTTCAGATTTGTAAAAGG + Intergenic
1199984070 X:152937880-152937902 CCTCATGTCAGCTTTGGACATGG - Intronic
1200828214 Y:7665061-7665083 TCCAATTTCAATTTCTGACATGG - Intergenic